{"product_id":"proteintech-g68047-1-5c","title":"Proteintech, G68047-1-5C, MultiPro® 5CFLX Anti-Human Phospho-MEK1 (Ser298) (3F10G10)","description":"Size: 10ug\nThe Phospho-MEK1 (Ser298) (G68047-1-5C) by Proteintech is a Monoclonal antibody targeting Phospho-MEK1 (Ser298) in Single Cell (Intra) applications with reactivity to Human samples\nG68047-1-5C targets Phospho-MEK1 (Ser298) in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nMAP2K1 encodes MAPK1, also known as MEK1. MEK1 variants can enhance MEK1 expression and ERK1 phosphorylation that together lead to continuous activation of MEK\/ERK signaling pathway. MEK1 bind directly to ERK2 through a region in the N terminus of MEK. In addition, a proline-rich (PR) regulatory sequence in MEK is also involved in MEK-ERK association and signal propagation. The coupling between MEK1 and ERK2 is enhanced through phosphorylation on S298 in the MEK1 PR region, whereas phosphorylation on MEK1 T292 releases the complex. MEK1 T292 is a substrate of ERK2, but the site is also phosphorylated at a basal level when ERK2 is inhibited, suggesting several regulators of this site . Although the S298 site in MEK2 has been conserved, it lacks the T292 phosphorylation site, and it is not a substrate of PAK1. (PMID: 31972311, PMID: 17928366, PMID: 22177953)\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Peptide Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human Phospho-MEK1 (Ser298) (3F10G10)\nCalculated Molecular Weight: 43 kDa\nGenBank Accession Number: BC139729\nGene Symbol: MEK1\nGene ID (NCBI): 5604\nENSEMBL Gene ID: ENSG00000169032\nRRID: AB_3673970\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGCTCTAATAGTCGGCCCATATAAGAAA\nBarcode Sequence: TGCTCTAATAGTCGG\nForm: Liquid\nUNIPROT ID: Q02750\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888299462825,"sku":"G68047-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g68047-1-5c","provider":"Iright","version":"1.0","type":"link"}