{"product_id":"proteintech-g69001-1-5c","title":"Proteintech, G69001-1-5C, MultiPro® 5CFLX Anti-Human IL-6 (4G3E6)","description":"Size: 10ug\nThe NeutraKine® IL-6 (G69001-1-5C) by Proteintech is a Monoclonal antibody targeting NeutraKine® IL-6 in Single Cell (Intra) applications with reactivity to Human samples\nG69001-1-5C targets NeutraKine® IL-6 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nInterleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. IL-6 plays an essential role in the final differentiation of B-cells into Ig-secreting cells involved in lymphocyte and monocyte differentiation. It induces myeloma and plasmacytoma growth and induces nerve cells differentiation Acts on B-cells, T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. IL-6 is also considered a myokine, a cytokine produced from muscle, and is elevated in response to muscle contraction. IL-6 has been shown to interact with interleukin-6 receptor and glycoprotein 130. Additionally, IL-6 is involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.This antibody can be used to neutralize the bioactivity of IL-6.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: RecombinantProtein Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human IL-6 (4G3E6)\nGene Symbol: IL6\nGene ID (NCBI): 3569\nENSEMBL Gene ID: ENSG00000136244\nRRID: AB_3673972\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGACCGCACAGCGAATTCCCATATAAGAAA\nBarcode Sequence: ACCGCACAGCGAATT\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888299036841,"sku":"G69001-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g69001-1-5c","provider":"Iright","version":"1.0","type":"link"}