{"product_id":"proteintech-g69021-1-5c","title":"Proteintech, G69021-1-5C, MultiPro® 5CFLX Anti-Human IL-17A (1F3E3)","description":"Size: 10ug\nThe NeutraKine® IL-17A (G69021-1-5C) by Proteintech is a Monoclonal antibody targeting NeutraKine® IL-17A in Single Cell (Intra) applications with reactivity to Human samples\nG69021-1-5C targets NeutraKine® IL-17A in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nIL17A, also named as IL-17, is a proinflammatory cytokine. IL-17, synthesized only by memory T cells and natural killer cells, has pleiotropic effects, mainly in the recruitment and activation of neutrophils. This cytokine regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2\/COX-2), as well as enhance the production of nitric oxide (NO). High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. The IL-17 receptor is a type I transmembrane protein, that is widely expressed on epithelial cells, fibroblasts, B and T cells, and monocytic cells. In psoriatic skin lesions, both Th17 cells and their downstream effector molecules, e.g. IL-17 and IL-22, are highly increased.This antibody can be used to neutralize the bioactivity of IL-17A.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: RecombinantProtein Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human IL-17A (1F3E3)\nGene Symbol: IL-17A\nGene ID (NCBI): 3605\nENSEMBL Gene ID: ENSG00000112115\nRRID: AB_3673974\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTAGCGCTACCTAACCCCATATAAGAAA\nBarcode Sequence: CTAGCGCTACCTAAC\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888298971305,"sku":"G69021-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g69021-1-5c","provider":"Iright","version":"1.0","type":"link"}