BRAND / VENDOR: BD

BD, 572178, BD® OMICS-One T-cell Protein Panel

CATALOG NUMBER: 572178

Regular price$0.99
/
Shipping calculated at checkout.
  • In stock
  • Backordered, shipping soon

このサイトはhCaptchaによって保護されており、hCaptchaプライバシーポリシーおよび利用規約が適用されます。

Product Description

Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Regulatory Status: RUO
Storage Buffer: Lyophilized powder containing BSA and ≤ 0.25% sodium azide.
Description: Description The BD® OMICS-One T-Cell Protein Panel consists of 30 different specificities against major T-cell markers in a single tube. Designed and optimized to work on the BD Rhapsody™ System, the T-Cell Protein Panel is tested to work seamlessly alongside the BD Rhapsody™ Whole Transcriptome Analysis (WTA) Assay, Targeted mRNA Assay, BD® Single-Cell Multiplexing Kit (SMK), BD® Intracellular CITE-seq (IC-AbSeq) Assay, and BD Rhapsody™ TCR/BCR Next Multiomic Assay for humans. The individual antibodies were each conjugated to an oligonucleotide that contains a specific antibody barcode sequence flanked by a polyA tail on the 3' end and a common PCR handle (PCR primer binding site) on the 5' end. To allow for sequencing error correction and unique mapping, all AbSeq barcode sequences were generated in silico with minimal sequence similarity to the human genomes, have low predicted secondary structure, and have high Hamming distance within the BD antibody-oligo portfolio. The polyA tail of the oligonucleotide allows the barcode sequence to be captured by the BD Rhapsody™ Enhanced Cell Capture Beads. The 5' PCR handle allows for efficient sequencing library generation for various sequencing platforms. Each individual antibody exists at an optimal concentration within the 30-plex to enable superior target and population resolution. The T-Cell Protein Panel is designed with SMART technology. SMART technology helps lower sequencing cost while increasing data resolution by attenuating antibodies that target high-expressing primary markers and by allowing re-allocation of sequencing reads to markers expressed at lower levels. With SMART technology, markers low in expression can be quantified without having to do deeper sequencing and incurring high sequencing cost. The two specificities attenuated in the T-Cell Protein Panel are CD4 and CD44.
Preparation And Storage: Preparation And Storage Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
Recommended Assay Procedures: Recommended Assay Procedures This reagent is provided lyophilized in a pre-titrated format. 1. Remove the BD® OMICS-One T-Cell Protein Panel tube from the foil bag and bring up to room temperature for 5 minutes. 2. Make sure the pellet is located at the bottom of the tube. If not, briefly centrifuge to collect the contents at the tube bottom. 3. Add 35 µL   of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibodies immediately before cell staining. Prolonged incubation of reconstituted antibody might increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 60 plex or lower, prepare the BD® AbSeq labeling MasterMix in a 1.5-mL LoBind tube on ice. Note: For drop-in with more than 60 plex, reach out to technical support for calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        140 – (2.0 x N)     182 – (2.6 x N)     364 – (5.2 x N) Total                               140                 182                 364 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        120 – (2.0 × N)     156 – (2.6 × N)     312 – (5.2 × N) Total                               120                 156                 312 *  N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. †  FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, add 140 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 35 µL reconstituted T-Cell Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, add 120 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing 35 µL reconstituted T-Cell Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. Otherwise, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (Cat. No. 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component                           1 sample (µL)*    1 sample + 20% overage (µL) FBS† (catalog number 554656)        20.0              24.0 Fc Block‡ (catalog number 564220)   5.0               6.0 Total                               25.0              30.0 *  Sufficient for up to 1 million cells. To block more cells, adjust the volume. †  FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block =  BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 µL. Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 x g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. See BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8 minute incubation) as follows: a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. Place the cartridge on the BD Rhapsody™ HT Xpress and perform the following operations: _____________________________________________________________ Material to load        Volume (µL) 1 lane      Pipette Mode Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One T-Cell panel: _____________________________________________________________________________ Specificity     Clone      Oligo ID     BD® AbSeq Barcode Sequence CD103           Ber-ACT8   AHS0001      AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT CD137           4B4-1      AHS0003      TGACAAGCAACGAGCGATACGAAAGGCGAAATTAGT CD45RA          HI100      AHS0009      AAGCGATTGCGAAGGGTTAGTCAGTACGTTATGTTG CD69            FN50       AHS0010      CAATAACGGGTCATAGTAAGTCGCGAGTAAGAGGGC CD278           DX29       AHS0012      ATAGTCCGCCGTAATCGTTGTGTCGCTGAAAGGGTT CD134 (OX40)    ACT35      AHS0013      GGTGTTGGTAAGACGGACGGAGTAGATATTCGAGGT CD279 (PD-1)    EH12.1     AHS0014      ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD366 (TIM-3)   7D3        AHS0016      TAGGTAGTAGTCCCGTATATCCGATCCGTGTTGTTT CD223 (Lag3)    T47-530    AHS0018      CGGCATGAATTAGGCGAGACTTAGTATACGAGCTGG CD95 (Fas)      DX2        AHS0023      GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD25            2A3        AHS0026      AGTTGTATGGGTTAGCCGAGAGTAGTGCGTATGATT CD127           HIL-7R-M21 AHS0028      AGTTATTAGGCTCGTAGGTATGTTTAGGTTATCGCG CD183           1C6/CXCR3  AHS0031      AAAGTGTTGGCGTTATGTGTTCGTTAGCGGTGTGGG CD4             SK3        AHS0032      TCGGTGTTATGAGTAGGTCGTCGTGCGGTTTGATGT CD196 (CCR6)    11A9       AHS0034      ACGTGTTATGGTGTTGTTCGAATTGTGGTAGTCAGT CD45RO          UCHL1      AHS0036      TGAGAGGTTATTGGGCGTATGACTTCGGTGATTGTG CD194 (CCR4)    1G1        AHS0038      AATATTAGTGGGTCCTCGCGTTGGCCGGTTGTTAGT CD62L           DREG-56    AHS0049      ATGGTAAATATGGGCGAATGCGGGTTGTGCTAAAGT CD272           J168-540   AHS0052      GTAGGTTGATAGTCGGCGATAGTGCGGTTGAAAGCT CD154           TRAP1      AHS0077      TAAGAGGTAAGTGCATTCGGGTATAGGCGTGATTTG CD357 (GITR)    V27-580    AHS0104      TCTGTGTGTCGGGTTGAATCGTAGTGAGTTAGCGTG CD28            L293       AHS0138      TTGTTGAGGATACGATGAAGCGGTTTAAGGGTGTGG TCRgd           11F2       AHS0142      CTCGTGGGTTAGGCTTGATCGTAGTTATGTATGGTT CD44            L178       AHS0167      GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG TCR Va24-Ja18   6B11       AHS0175      TTCTGGTTCGGTTGAGCTACTAATTTCGTTGGATGG CD161 (KLRB1)   HP-3G10    AHS0205      TTTAGGACGATTAGTTGTGCGGCATAGGAGGTGTTC CD8             SK1        AHS0228      AGGACATAGAGTAGGACGAGGTAGGCTTAAATTGCT CD3             UCHT1      AHS0231      AGCTAGGTGTTATCGGCAAGTTGTACGGTGAAGTCG CD197 (CCR7)    2-L1-A     AHS0273      AATGTGTGATCGGCAAAGGGTTCTCGGGTTAATATG TIGIT           tgMab-2    AHS0411      AGAGGGTTTAGTCAAGGTCGTGCGTATAGTTCAGGT
Product Notices: Product Notices This reagent is provided lyophilized in a pre-titrated format. Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. Source of all serum proteins is from USDA inspected abattoirs located in the United States. For U.S. patents that may apply, see bd.com/patents. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924