{"product_id":"biolegend-304951","title":"Biolegend, 304951, TotalSeq™-D0218 anti-human CD62P (P-Selectin) Antibody, 10μg","description":"\u003cp\u003eCD62P is a 140 kD type I transmembrane glycoprotein also known as P-selectin, platelet activation-dependent granule membrane protein (PADGEM), and GMP-140. It is expressed on activated platelets, megakaryocytes, and endothelial cells. CD62P is primarily stored in secretory α-granules in platelets and Weibel-Palade bodies in endothelial cells, and is rapidly relocated to the plasma membrane upon activation. The ligands for CD62P are CD162 and CD24. A primary function of CD62P is cell adhesion during neutrophil rolling, and platelet-neutrophil and platelet-monocyte interactions.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: Chimpanzee\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections4 and in vitro blocking of adhesion of platelets1. The Ultra-LEAF™ purified antibody (Endotoxin \u0026lt; 0.01 EU\/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 304947 \u0026amp; 304948).\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Skinner M, et al. 1991. J. Biol. Chem. 266:5371. (Block) Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London. Yen YT, et al. 2006. J. Virol. 80:2684. Sato Y, et al. 2005. Blood 106:428. (IHC)\u003cbr\u003e\nRRID: AB_2892359 (BioLegend Cat. No. 304951)\u003cbr\u003e\nStructure: Selectin, type I glycoprotein, 140 kD\u003cbr\u003e\nDistribution: Activated platelets, megakaryocytes, endothelial cells\u003cbr\u003e\nFunction: Adhesion, neutrophil rolling, platelet-neutrophil and platelet-monocyte interactions\u003cbr\u003e\nLigand\/Receptor: CD162 (PSGL-1), CD24 and sialylated Lewis X\u003cbr\u003e\nCell Type: Endothelial cells, Megakaryocytes, Neutrophils, Platelets\u003cbr\u003e\nBiology Area: Cell Adhesion, Cell Biology, Immunology, Neuroscience, Synaptic Biology\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: 1. McEver R, et al. 1995. J. Biol. Chem. 270:11025. 2. Varki A. 1994. P. Natl. Acad. Sci. USA 91:7390.\u003cbr\u003e\nGene ID: 6403\u003cbr\u003e\nUniProt: View information about CD62P on UniProt.org\u003cbr\u003e\nClone: AK4\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: VI P-44\u003cbr\u003e\nOther Names: GMP-140, PADGEM\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CCTTCCGTATCCCTT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862538506409,"sku":"304951","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-304951","provider":"Iright","version":"1.0","type":"link"}