{"product_id":"biolegend-329627","title":"Biolegend, 329627, TotalSeq™-D0008 anti-human CD273 (B7-DC, PD-L2) Antibody, 10μg","description":"\u003cp\u003eCD273, known as B7-DC, is also called programmed death ligand 2 (PDL2). This ligand is a 25 kD type I transmembrane protein and a member of B7 family within the immunoglobulin receptor superfamily and is expressed on a subset of dendritic cells, liver and a small subset of macrophages as well as a few transformed cell lines. CD273 has been reported to be stimulatory on dendritic cells when cross-linked and to inhibit T cell activation upon engaging the PD-1 receptor. CD273 has also been reported to bind to an alternative receptor and to mediate T cell activation through such non-PD1 mediated interactions.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Human PD-L2 cDNA\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Brown JA, et al. 2003. J. Immunol. 170:1257 Rodig N, et al. 2003. Eur. J. Immunol. 33:3117\u003cbr\u003e\nRRID: AB_2892396 (BioLegend Cat. No. 329627)\u003cbr\u003e\nStructure: B7 Immunoglobulin superfamily, 25 kD\u003cbr\u003e\nDistribution: Dendritic cells, liver, few transformed cell lines, subset of macrophages\u003cbr\u003e\nFunction: Binds to PD-1 and alternative receptor; ligation on DC stimulates, inhibits T cell responses via PD-1 binding, stimulates T cells via alternative receptor binding and promotes tumor immunity\u003cbr\u003e\nLigand\/Receptor: PD-1\u003cbr\u003e\nCell Type: Dendritic cells, Macrophages\u003cbr\u003e\nBiology Area: Costimulatory Molecules, Immunology\u003cbr\u003e\nMolecular Family: CD Molecules, Immune Checkpoint Receptors\u003cbr\u003e\nAntigen References: 1. Shin T, et al. 2003. J. Exp. Med. 198:31. 2. Liu X, et al. 2003. J. Exp. Med. 197:1721. 3. Carreno BM, et al. 2002. Annu. Rev. Immunol. 20:29.\u003cbr\u003e\nGene ID: 80380\u003cbr\u003e\nUniProt: View information about CD273 on UniProt.org\u003cbr\u003e\nClone: 24F.10C12\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: B7-DC, PD-L2, PDL2, B7DC\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: TCAACGCTTGGCTAG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46860877725865,"sku":"329627","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-329627","provider":"Iright","version":"1.0","type":"link"}