{"product_id":"biolegend-331955","title":"Biolegend, 331955, TotalSeq™-D0101 anti-human CD335 (NKp46) Antibody, 10μg","description":"\u003cp\u003eCD335, also known as NKp46, is a member of the natural cytotoxicity receptor (NCR) family which triggers cytotoxicity in NK cells. CD335 is direct­ly involved in target cell recognition and lysis, and is exclusively expressed on CD3 - CD56 + NK cells, suggesting it is a universal marker for NK cells. NKp46, along with NKp30 and NKp44, is referred to as a natural cytoxicity receptor (NCR) and plays a very important role in killing virus-infected tumor cells and MHC-class I-unprotected cells.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: NKp46-Fc fusion protein\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone 9E2 has been shown to block NK activation through NKp46.6\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Nakajima H, et al. 2000. Eur. J. Immunol. 30:3309. Kalberer CP, et al. 2003. Blood 102:127. Chen Y, et al. 2007. J. Immunol. 179:2766. Jarahian M, et al. 2009. J. Virol. 83:8108. PubMed Correia DV, et al. 2011. Blood 118:992. (FC) PubMed Achdout H. et al. 2010. J. Virol. 84:3993.\u003cbr\u003e\nRRID: AB_2936626 (BioLegend Cat. No. 331955)\u003cbr\u003e\nStructure: Type I membrane glycoprotein (46 kD)\u003cbr\u003e\nDistribution: Expressed on resting and activated NK cells\u003cbr\u003e\nCell Type: NK cells\u003cbr\u003e\nBiology Area: Immunology, Innate Immunity\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. Mandelboim O and Porgador A. 2001. Int. J. Biochem. Cell Biol. 33:1147. 2. Nakajima H, et al. 2000. Eur. J. Immunol. 30:3309. 3. Sivori S. 1999. Eur. J. Immunol. 29:1656.\u003cbr\u003e\nGene ID: 9437\u003cbr\u003e\nUniProt: View information about CD335 on UniProt.org\u003cbr\u003e\nClone: 9E2\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: NKp46, NCR1\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: ACAATTTGAACAGCG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862508884137,"sku":"331955","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-331955","provider":"Iright","version":"1.0","type":"link"}