{"product_id":"biolegend-339029","title":"Biolegend, 339029, TotalSeq™-D0246 anti-human CD122 (IL-2Rβ) Antibody, 10μg","description":"\u003cp\u003eCD122 is a 70-75 kD type I transmembrane glycoprotein and member of the Ig superfamily. It is IL-2 receptor β chain also known as IL-2Rβ, which is also shared by the IL-15 receptor. CD122 is constitutively expressed by NK cells and at lower levels by a subset of T cells. Its expression is upregulated upon activation. The IL-2Rβ chain can combine with either the common γ subunit (γc, CD132) alone or with the γc subunit and the IL-2Rα subunit (CD25) to generate intermediate or high affinity IL-2 receptor complexes, respectively. CD122 expression levels can be upregulated by activation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: TL-Mor cell line\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications include (for the relevant formats) include: immunoprecipitation, blocking of IL-2 binding to CD122, and partial inhibition of IL-2 induced cell proliferation.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Takeshita T, et al. 1989. J. Exp. Med. 169:1323.\u003cbr\u003e\nRRID: AB_2894591 (BioLegend Cat. No. 339029)\u003cbr\u003e\nStructure: Ig superfamily, forms high affinity IL-2 receptor with CD25 and CD132 chains or intermediate affinity receptor with CD132 alone, 70-75 kD\u003cbr\u003e\nDistribution: NK cells, T subset\u003cbr\u003e\nFunction: Critical component of IL-2 and IL-15 signaling\u003cbr\u003e\nLigand\/Receptor: IL-2, IL-15\u003cbr\u003e\nCell Type: NK cells, T cells, Tregs\u003cbr\u003e\nBiology Area: Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers\u003cbr\u003e\nMolecular Family: CD Molecules, Cytokine\/Chemokine Receptors\u003cbr\u003e\nAntigen References: 1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers Wiley-Liss A John Wiley \u0026amp; Sons Inc, Publication 2. Minami Y, et al. 1993. Annu. Rev. Immunol. 11:245. 3. Suzuki H, et al. 1995. Science 268:1472.\u003cbr\u003e\nGene ID: 3560\u003cbr\u003e\nUniProt: View information about CD122 on UniProt.org\u003cbr\u003e\nClone: TU27\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: V C050\u003cbr\u003e\nOther Names: IL-2 Receptor β chain, IL-2Rβ\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: TCATTTCCTCCGATT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46864048914601,"sku":"339029","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-339029","provider":"Iright","version":"1.0","type":"link"}