{"product_id":"biolegend-349527","title":"Biolegend, 349527, TotalSeq™-D0373 anti-human CD81 (TAPA-1) Antibody, 10μg","description":"\u003cp\u003eCD81 is a 26 kD non-glycosylated member of the tetraspanin superfamily (TM4SF), also known as TAPA-1 (target of an antiproliferative antibody). CD81 is expressed on T and B cells, NK cells, monocytes, dendritic cells, thymocytes, endothelial cells, and fibroblasts. It also has low levels of expression on granulocytes. CD81 induces B cell adhesion via VLA-4 integrin and has been shown to play a role in early T cell development. CD81 associates with several other cell-surface proteins in a multimolecular complex, including CD19, CD21, CD20, CD37, CD53, and CD82 in B cells, and CD4, CD8, and CD82 in T cells.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Human OCI-LY8 cell line\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG – Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include: Western Blotting3 and immunoprecipitation2,3.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Van Zelm MC, et al. 2010. J. Clin. Invest. 120:1265. Oren R, et al. 1990. Mol. Cell. Biol. 8:4007. (IP) Clark K, et al. 2004. J. Biol. Chem. 279(19):19401. (IP, WB) Mochida K, et al. 2008. J. Virol. 13:6711. Rappa G, et al. 2014. Mol Cancer Res. 12:1840. PubMed\u003cbr\u003e\nRRID: AB_2910399 (BioLegend Cat. No. 349527)\u003cbr\u003e\nStructure: 26 kD, type III transmembrane protein, member of the TM4SF tetraspanin family. Complexed with CD82, CD19, CD21, or CD4, CD8.\u003cbr\u003e\nDistribution: T cells, NK, monocytes, B cells, endothelial and epithelial cells, low on granulocytes.\u003cbr\u003e\nFunction: Regulates cell activation and growth and cell aggregation.\u003cbr\u003e\nCell Type: B cells, Endothelial cells, Epithelial cells, Monocytes, Neural Stem Cells, NK cells, T cells\u003cbr\u003e\nBiology Area: Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Signal Transduction, Stem Cells, Transcription Factors\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: Van Zelm MC, et al. 2010. J. Clin. Invest. 120:1265. Fearon D, et al. 1995. Annu. Rev. Immunol. 13:127. Wright M, et al. 1994. Immunol. Today 15:588.\u003cbr\u003e\nGene ID: 975\u003cbr\u003e\nUniProt: View information about CD81 on UniProt.org\u003cbr\u003e\nClone: 5A6\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: S5.7, CVID6, TSPAN28\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: GTATCCTTCCTTGGC\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862447214761,"sku":"349527","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-349527","provider":"Iright","version":"1.0","type":"link"}