{"product_id":"biolegend-362919","title":"Biolegend, 362919, TotalSeq™-D1261 anti-human CD191 (CCR1) Antibody, 10μg","description":"\u003cp\u003eCD191, also known as CCR1, is a 41 kD, G-protein coupled receptor expressed predominantly by monocytes. CCR1 is also expressed by a subset of T cells and eosinophils. CCR1 positive cells can migrate in response to a CCL3 and CCL5 gradient. CCR1 knock-out studies suggest that this molecule plays an important role in inflammation and susceptibility to viruses and parasites.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Human CCR1 transfected cells\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nRRID: AB_2936584 (BioLegend Cat. No. 362919)\u003cbr\u003e\nStructure: G-protein coupled receptor, seven transmembrane protein, 41 kD\u003cbr\u003e\nDistribution: Monocytes, macrophages, subset of T cells, eosinophils\u003cbr\u003e\nFunction: Regulates migration of cells in response to CCL3 and CCL5\u003cbr\u003e\nLigand\/Receptor: CCL3 and CCL5\u003cbr\u003e\nCell Type: Eosinophils, Macrophages, Monocytes, T cells\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: CD Molecules, Cytokine\/Chemokine Receptors, GPCR\u003cbr\u003e\nAntigen References: 1. Su SB, et al. 1996. J. Leuko. Biol. 60:658. 2. Su S, et al. 1997. Blood. 90:605. 3. Ayehunie S, et al. 1997. Blood. 90:1379. 4. Gerard C, et al. 1997. J. Clin. Invest. 100:2022. 5. Tiffany HL, et al. 1998. J. Immunol. 160:1385. 6. Gilliland CT, et al. 2013. J. Biol. Chem. 288:32194. 7. Bednar F, et al. 2014. J. Immunol. 192:5305.\u003cbr\u003e\nGene ID: 1230\u003cbr\u003e\nUniProt: View information about CD191 on UniProt.org\u003cbr\u003e\nClone: 5F10B29\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: CKR1, CD191, HM145, SCYAR1, CMKRB1\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CCTTTCCGACATTGG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46864375382185,"sku":"362919","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-362919","provider":"Iright","version":"1.0","type":"link"}