{"product_id":"biolegend-394019","title":"Biolegend, 394019, TotalSeq™-D0594 anti-human CD133 Antibody, 10μg","description":"\u003cp\u003eCD133, also known as Prominin-1 and AC133 antigen, is a 120 kD pentaspan glycoprotein with 5 transmembrane domains. CD133 was initially described as a surface antigen specific for human hematopoietic stem cells and as a marker for murine neuroepithelial cells and some embryonic epithelia. Later on, CD133 was found on other stem cells, including endothelial progenitor cells, glioblastomas, neuronal, and glial stem cells. In addition to stem cells for normal tissue, CD133 was found on cancer cells, such as some leukemia cells and brain tumor cells. Although the biological function of CD133 is not completely understood, CD133 has been extensively used as a stem cell marker for normal and cancerous tissues.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Human CD133 transfectants\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: In-house testing suggests that clone S16016B blocks clone AC133 but not clone 7 that are also raised against human CD133.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nRRID: AB_2910453 (BioLegend Cat. No. 394019)\u003cbr\u003e\nStructure: 120 kD pentaspan transmembrance glycoprotein with 5 transmembrane domains\u003cbr\u003e\nDistribution: Hematopoietic stem cells and progenitor cells, fetal liver cells, tissue specific stem cells or progenitor cells such as renal and prostate, a variety of tumor cells\u003cbr\u003e\nFunction: May play a role in cell differentiation, proliferation, and apoptosis\u003cbr\u003e\nInteraction: NAT8; NAT8B; CDHR1\u003cbr\u003e\nCell Type: Hematopoietic stem and progenitors\u003cbr\u003e\nBiology Area: Cancer Biomarkers, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: Yin AH, et al. 1997. Blood. 90:5002. Miraglia S, et al. 1997. Blood. 90:5013. Bühring HJ, et al. 1999. Ann. NY Acad. Sci. 872:25.\u003cbr\u003e\nGene ID: 8842\u003cbr\u003e\nUniProt: View information about CD133 on UniProt.org\u003cbr\u003e\nClone: S16016B\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: Prominin-1, PROM1, AC133\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: GTAAGACGCCTATGC\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46866224840873,"sku":"394019","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/biolegend-394019","provider":"Iright","version":"1.0","type":"link"}