{"product_id":"neb-m0653s","title":"New England Biolabs, M0653S, EnGen® Lba Cas12a (Cpf1)","description":"EnGen Lba Cas12a (Cpf1) is a programmable DNA endonuclease guided by a single guide RNA (gRNA). Targeting requires a gRNA complementary to the target site as well as a 5' TTTV protospacer adjacent motif (PAM) on the DNA strand opposite the target sequence. Cleavage by EnGen Lba Cas12a (Cpf1) occurs ~17 bases 3' of the PAM and leaves 5' overhanging ends.  \u003cb\u003eRelated Categories\u003c\/b\u003e CRISPR\/Cas Nucleases  \u003cb\u003eSpecification\u003c\/b\u003e \u003cb\u003eReaction Conditions\u003c\/b\u003e 1X NEBuffer™ r2.1 Incubate at 37°C 1X NEBuffer™ r2.1 50 mM NaCl 10 mM Tris-HCl 10 mM MgCl2 100 µg\/ml Recombinant Albumin (pH 7.9 @ 25°C)  \u003cb\u003eStorage Buffer\u003c\/b\u003e 500 mM NaCl 20 mM sodium acetate 0.1 mM EDTA 0.5 mM TCEP-HCl 50% Glycerol pH 6 @ 25°C  \u003cb\u003eHeat Inactivation\u003c\/b\u003e 65°C for 10 minutes  \u003cb\u003eFAQ\u003c\/b\u003e Q: What are the differences between EnGen® Lba Cas12a (Cpf1) (NEB #M0653) and EnGen Spy Cas9 NLS (NEB #M0646)? A: There are a number of differences between EnGen Lba Cas12a (Cpf1) and EnGen Spy Cas9 NLS. These differences are summarized in the table below. EnGen Spy Cas9 NLS EnGen Lba Cas12a (Cpf1) Classification Class II Type II Class II Type V Nuclease Domains RuvC and HNH RuvC only Size 161.3 kDa 150.9 kDa Guide RNA Length ~100 nt ~41-44 nt PAM Sequence NGG TTTN Cleavage Site 3 bases 5´ of the PAM ~18 bases 3´ of the PAM Termini of Cleaved Product Blunt ends 5´ overhang Q: Which nuclear localization signal is fused to EnGen® Lba Cas12a (Cpf1)? A: EnGen Lba Cas12a (Cpf1) contains the Simian virus 40 (SV40) T antigen nuclear localization signal (NLS) on the N and C-termini of the protein. Q: Why am I observing limited or no digestion with EnGen® Lba Cas12a (Cpf1)? A: Incomplete digestion may be due to the following factors: Incorrect ratio of EnGen Lba Cas12a (Cpf1) to gRNA and\/or target site. For complete digestion we recommend a 10:10:1 or higher molar ratio of EnGen Lba Cas12a (Cpf1) : gRNA : target site. Suboptimal sequence of the gRNA. Verify the sequence and design of the gRNA. Poor quality gRNA. Verify the integrity of the gRNA by gel electrophoresis. Use of a suboptimal buffer. Please use EnGen Lba Cas12a Diluent, which is included with the enzyme. When diluting 100 µM EnGen Lba Cas12a (Cpf1) for use in in vitro cleavage assays, supplementing reactions with 10 mM DTT can in some cases improve substrate cleavage. Q: Can mutations generated with EnGen Lba Cas12a (Cpf1) be detected using T7 Endonuclease I (NEB #M0302) or the EnGen Mutation Detection Kit (NEB #E3321S)? A: Yes, both of these products can be used to detect genome editing events generated with EnGen Lba Cas12a (Cpf1). Q: Can gRNA for use with EnGen Lba Cas12a (Cpf1) be generated using the EnGen sgRNA Synthesis Kit, S. pyogenes (NEB #E3322)? A: No, the EnGen sgRNA Synthesis Kit, S. pyogenes cannot be used to make gRNAs for EnGen Lba Cas12a (Cpf1). The scaffold oligo in the 2X sgRNA Reaction Mix scaffold DNA, which contains the tracrRNA sequence, is only compatible with S. pyogenes Cas9. Q: How do I design a guide RNA for use with EnGen Lba Cas12a? A: The guide RNA (crRNA) for EnGen Lba Cas12a has the following sequence: 5´- UAAUUUCUACUAAGUGUAGAUCCACUCACUGCUUUCUCCUC -3´ The underlined sequence is the crRNA repeat and will be the same for all EnGen Lba Cas12a guides. The repeat is followed by a target specific sequence (not underlined), which will vary depending on the target. The targeting sequence can vary from 18-24 nt, but should never contain the PAM (TTTV). The PAM motif should be on the 5´ end of the non-complementary DNA sequence being targeted. Below is an example showing what the DNA sequence for the above crRNA should look like with the PAM underlined. Q: How do I dilute the enzyme to 1 μM for in vitro reactions? A: If planning to use higher concentration EnGen Lba Cas12a (NEB #M0653T) for in vitro digestion of DNA, the 100 μM enzyme can be diluted to lower concentrations in EnGen Lba Cas12a Diluent (B0653A). The enzyme is stable and can be stored at -20°C in this diluent. Q: Can you tell me more about the switch from BSA to Recombinant Albumin (rAlbumin) in NEBuffers? A: NEB is excited to announce that we have switched BSA-containing reaction buffers (NEBuffer 1.1, 2.1, 3.1 and CutSmart® Buffer) to Recombinant Albumin-containing buffers (NEBuffer r1.1, r2.1, r3.1 and rCutSmart™ Buffer). We are also in the process of moving all restriction enzyme formulations to contain rAlbumin. We feel that moving away from animal-containing products is a step in the right direction and are able to offer this enhancement at the same price. Q: What is in EnGen Lba Cas12a Diluent (NEB #B0653A)? A: EnGen Lba Cas12a Diluent (NEB #B0653A) has the following composition: 500 mM NaCl, 20 mM sodium acetate, 0.5 mM EDTA, 0.5 mM TCEP-HCl, 50% Glycerol, pH 6 @ 25°C. It has exactly the same composition as the enzyme Storage Buffer. EnGen Lba Cas12a Diluent (NEB #B0653A) should be used to dilute 100 μM EnGen Lba Cas12a to lower concentrations for in vitro reactions, if required. ","brand":"New England Biolabs","offers":[{"title":"Default Title","offer_id":46835543408809,"sku":"M0653S","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/neb-m0653s","provider":"Iright","version":"1.0","type":"link"}