{"product_id":"neb-n0378s","title":"New England Biolabs, N0378S, pMAL-c6T Vector","description":"The pMAL-c6T Vector is designed to produce maltose-binding protein (MBP) fusions in the cytoplasm. The MBP has been engineered for tighter binding to amylose resin. The vector expresses an N-terminal his-tagged  \u003cb\u003eRelated Categories\u003c\/b\u003e NEBExpress MBP Fusion and Purification System,, Bacterial E. coli Protein Expression,, DNA Plasmids \u0026amp; Substrates,  \u003cb\u003eApplications\u003c\/b\u003e Target Protein Insolubility ,, Non-T7 Expression,, Expression of Difficult Proteins,  \u003cb\u003eSpecification\u003c\/b\u003e \u003cb\u003eAffinity Tag\u003c\/b\u003e Maltose-Binding Protein (MBP)  \u003cb\u003eSequence Files\u003c\/b\u003e Fasta GenBank  \u003cb\u003eFAQ\u003c\/b\u003e Q: What strain(s) do you recommend as hosts for the pMAL vectors? A: We recommend NEBExpress Competent E. coli (NEB #C2523). This is an E. coli B strain similar to T7 Express and BL21 (DE3), except that it lacks the T7 RNA Polymerase (the pMAL vectors use the E. coli RNA Polymerase). NEB Express, T7 Express (NEB #C2566), BL21 (NEB #C2530) and BL21(DE3) (NEB #C2527) Competent E. coli all give similar results – the presence of the T7 RNA Polymerase doesn't seem to have any effect. Other successful strains include NEB 10-beta (NEB #C3019) and NEB Turbo (NEB #C2984) Competent E. coli. One can start with NEB Express, or with whatever competent cells are readily available, and then try another strain if a problem with expression or purification develops. Q: What primers should I use to sequence the ends of my insert after I clone it into a pMAL vector? A: The following sequencing primers can be used (not available from New England Biolabs): malE primer on the 5′ side of the insert and the pMAL reverse primer for sequencing from the 3′ side. Forward Primer (24-mer, upstream of MCS) 5′d(GGTCGTCAGACTGTCGATGAAGCC)3′ Reverse Primer (24-mer, downstream of MCS) 5′d(TGTCCTACTCAGGAGAGCGTTCAC)3′ The sequences of the pMAL vectors are also available at www.neb.com. PCR of inserts cloned into the MCS can be performed using the same primer pair. Q: What is the minimum size of a fragment that can be cloned into pMAL and expressed fused to MBP? Can short peptide sequences (~ 10 amino acids) be added onto MBP? A: The MBP system can be used to express short peptides. However, 40 mg of MBP yields ~1 mg of a 10 amino acid peptide (1.1 kDa). Q: What is the DNA sequence of this product? A: The DNA Sequence can be found in the DNA Sequences and Maps Tool. Q: What are the differences between the generations of pMAL vectors (e.g. pMAL-c2 vs. pMAL-c5 vs. pMAL-c6 or pMAL-p2 vs. pMAL-p5)? A: In all vectors, the “-c’’ designation refers to cytoplasmic expression, i.e. the signal sequence that directs MBP to the periplasmic space has been deleted. Vectors that are designated “-p’’ refer to periplasmic expression, and these contain the wildtype malE signal sequence. 1st Generation pMAL vectors: The pMAL-c, -cRI and -p are the earliest versions of the pMAL vectors. pMAL-c and pMAL-p have a StuI site in the polylinker for cloning blunt-ended fragments. Because the second half of the StuI site codes for proline, if an EcoRI fragment was cloned into pMAL-c or pMAL-p, the Factor Xa site reads IEGRP, and RP won't cut with Factor Xa. pMAL-cRI was designed as a short-term solution to fix this problem, by changing the polylinker to code for IEGRI upstream of the EcoR I site. 2nd Generation pMAL-2 vectors: The pMAL-c2 and pMAL-p2 vectors are the next generation of pMAL vectors. These vectors avoid the problem with Factor Xa cleavage by using an XmnI site instead of StuI. They also have a spacer between malE and the Factor Xa site which allows some fusions to bind more tightly to the amylose resin, and an M13 origin for making single stranded DNA. 3rd Generation pMAL vectors: The third generation of pMAL vectors is distinguished by the addition of vectors that substitute an Enterokinase or Genenase I site for the Factor Xa site. These vectors are called pMAL-c2E and pMAL-p2E (Enterokinase), and pMAL-c2G and pMAL-p2G (Genenase). The Factor Xa versions are now called pMAL-c2X and pMAL-p2X for consistency. This third generation of vectors have a few minor modifications outside the polylinker as well. The NdeI site in the pBR322 origin was destroyed by filling in, and an NdeI site at the ATG of malE was added by site directed mutagenesis. This allows a malE fusion to be cut out in order to subclone it, for example into a eukaryotic vector. The NcoI site in malE was destroyed, as was the AvaI site in the M13 origin, making the AvaI site upstream of the Factor Xa site unique. pMAL-III vector: This is a special purpose derivative of pMAL-p2, designed to facilitate direct transfer of sequences selected from any of the Ph.D. phage display peptide libraries into an expression vector. Unlike the other pMAL vectors, which place the sequence of interest downstream of malE, in this vector the sequence encoding the peptide is fused to the N-terminus of malE. 4th Generation pMAL-4 vectors: The pMAL-4 vectors are similar to the pMAL-2 vectors, except the MBP has been engineered for tighter binding to amylose. The vector backbone and the multiple cloning site are identical to the pMAL-2 vectors. 5th Generation pMAL-5 vectors: The pMAL-5 vectors share the engineered malE gene with the pMAL-4 vectors, but have a different multiple cloning site and some differences in the vector backbone. The multiple cloning site is identical to that of pKLAC2 and pTYB21, thereby facilitating the subcloning of the same insert into multiple vectors: pKLAC2 for expression in K. lactis using the K. lactis Expression Kit (#E1000) or pTYB21 for expression in E. coli using the IMPACT kit (#E6901). The multiple cloning site is followed by stop codons in all three frames, and the vector backbone does not carry the lacZα gene or M13 origin. 6th Generation pMAL-6 vector: The pMAL-c6T vector shares the engineered malE gene with the pMAL-4 and 5 series vectors but contains an N-terminal hexahistidine tag. The pMAL-c6T vector has a different multiple cloning site, but still contains stop codons in all three frames and shares a subset of restriction enzyme recognition sequences with those found in the pKLAC2 vector for expression in K. lactis using the K. lactis Expression Kit (#E1000) or pTYB21 for expression in E. coli using the IMPACT kit (#E6901). A TEV protease recognition site has been substituted for the Factor Xa protease recognition site in the polylinker between MBP and the target protein of interest. The vector backbone does not carry the lacZα gene or M13 origin. Note that there is no 6th generation vector for secretion of MBP-fusion proteins to the periplasm. ","brand":"New England Biolabs","offers":[{"title":"Default Title","offer_id":46835505823913,"sku":"N0378S","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/neb-n0378s","provider":"Iright","version":"1.0","type":"link"}