{"product_id":"proteintech-g65067-1-5c","title":"Proteintech, G65067-1-5C, MultiPro® 5CFLX Anti-Human CD56 (MEM-188)","description":"Size: 10ug\nThe CD56 (G65067-1-5C) by Proteintech is a Monoclonal antibody targeting CD56 in Single Cell (Intra) applications with reactivity to Human samples\nG65067-1-5C targets CD56 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nNeural cell adhesion molecule 1 (NCAM1, also known as CD56) is a cell adhesion glycoprotein of the immunoglobulin (Ig) superfamily. It is a multifunction protein involved in synaptic plasticity, neurodevelopment, and neurogenesis. NCAM1 is expressed on human neurons, glial cells, skeletal muscle cells, NK cells and a subset of T cells, and the expression is observed in a wide variety of human tumors, including myeloma, myeloid leukemia, neuroendocrine tumors, Wilms' tumor, neuroblastoma, and NK\/T cell lymphomas.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG2a\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Acute myelogenous leukemia cell line KG-1 Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD56 (MEM-188)\nGenBank Accession Number: BC014205\nGene Symbol: NCAM1\nGene ID (NCBI): 4684\nENSEMBL Gene ID: ENSG00000149294\nRRID: AB_3673908\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTATCACTTGTCGTGCCCATATAAGAAA\nBarcode Sequence: CTATCACTTGTCGTG\nForm: Liquid\nUNIPROT ID: P13591\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297758889,"sku":"G65067-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65067-1-5c","provider":"Iright","version":"1.0","type":"link"}