{"product_id":"proteintech-g65086-1-5c","title":"Proteintech, G65086-1-5C, MultiPro® 5CFLX Anti-Human CD11c (3.9)","description":"Size: 10ug\nThe CD11c (G65086-1-5C) by Proteintech is a Monoclonal antibody targeting CD11c in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65086-1-5C targets CD11c in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nIntegrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11c, also known as integrin αX, is a type I transmembrane glycoprotein present on a variety of cells, including monocytes\/macrophages, granulocytes, a subset of B cells, NK cells and dendritic cells (PMID: 2897326; 1680915; 1694698; 17389580). As a result of its high level of expression on most dendritic cells, CD11c is typically considered to be a marker of conventional dendritic cells (PMID: 27119555). CD11c forms an α\/β heterodimer with CD18 (integrin β2). CD11c\/CD18 acts a receptor for fibrinogen and is important in monocyte adhesion and chemotaxis (PMID: 1671533).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Rheumatoid synovial cells and human monocytes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD11c (3.9)\nCalculated Molecular Weight: 1169 aa, 129 kDa\nGenBank Accession Number: BC038237\nGene Symbol: CD11c\nGene ID (NCBI): 3687\nENSEMBL Gene ID: ENSG00000140678\nRRID: AB_3673910\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGAAGCAATACTTATACCCCATATAAGAAA\nBarcode Sequence: AAGCAATACTTATAC\nForm: Liquid\nUNIPROT ID: P20702\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296153257,"sku":"G65086-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65086-1-5c","provider":"Iright","version":"1.0","type":"link"}