{"product_id":"proteintech-g65090-1-5c","title":"Proteintech, G65090-1-5C, MultiPro® 5CFLX Anti-Human CD16 (3G8)","description":"Size: 10ug\nThe CD16 (G65090-1-5C) by Proteintech is a Monoclonal antibody targeting CD16 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65090-1-5C targets CD16 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD16 is a 50-70-kDa low affinity Fc receptor found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. CD16 mediates antibody-dependent cellular cytotoxicity (ADCC) and other antibody-dependent responses, such as phagocytosis. CD16 has been identified as Fc receptors FcγRIIIa (CD16a) and FcγRIIIb (CD16b), encoded by two nearly identical genes, FCGR3A and the FCGR3B. Clone 3G8 recognizes both the CD16a and CD16b (PMID: 7592758).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD16 (3G8)\nCalculated Molecular Weight: 254 aa, 29 kDa\nGenBank Accession Number: BC017865\nGene Symbol: CD16a\nGene ID (NCBI): 2214\nENSEMBL Gene ID: ENSG00000203747\nRRID: AB_3673911\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGTGGAGTCTGGATCCCATATAAGAAA\nBarcode Sequence: GTGTGGAGTCTGGAT\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296349865,"sku":"G65090-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65090-1-5c","provider":"Iright","version":"1.0","type":"link"}