{"product_id":"proteintech-g65103-1-5c","title":"Proteintech, G65103-1-5C, MultiPro® 5CFLX Anti-Human CD40 (G28.5)","description":"Size: 10ug\nThe CD40 (G65103-1-5C) by Proteintech is a Monoclonal antibody targeting CD40 in Single Cell (Intra) applications with reactivity to Human samples\nG65103-1-5C targets CD40 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD40, also named as TNFRSF5 and Bp50, is a type I transmembrane protein that belongs to the tumor necrosis factor-R (TNF-R) family (PMID: 10647992). CD40 is expressed on B cells, dendritic cells (DCs), monocytes, platelets, and macrophages as well as by non-hematopoietic cells such as myofibroblasts, fibroblasts, epithelial, and endothelial cells (PMID: 19426221). It is a receptor for TNFSF5\/CD40LG. CD40L\/CD40 interactions are essential for immunoglobulin (Ig) isotype switching, germinal center formation and the development of B cell memory (PMID: 7516405; 11675497).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD40 (G28.5)\nCalculated Molecular Weight: 277 aa, 31 kDa\nGenBank Accession Number: BC012419\nGene Symbol: CD40\nGene ID (NCBI): 958\nENSEMBL Gene ID: ENSG00000101017\nRRID: AB_3673913\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTGCTATGACGTACCCCATATAAGAAA\nBarcode Sequence: ATTGCTATGACGTAC\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297332905,"sku":"G65103-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65103-1-5c","provider":"Iright","version":"1.0","type":"link"}