{"product_id":"proteintech-g65116-1-5c","title":"Proteintech, G65116-1-5C, MultiPro® 5CFLX Anti-Human CD11b (ICRF44)","description":"Size: 10ug\nThe CD11b (G65116-1-5C) by Proteintech is a Monoclonal antibody targeting CD11b in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65116-1-5C targets CD11b in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nIntegrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11b, also known as Integrin alpha M or CR3A, belongs to the integrin alpha chain family. CD11b forms an α\/β heterodimer with CD18 (integrin β2). CD11b\/CD18 is implicated in various adhesive interactions of monocytes, macrophages and granulocytes as well as in mediating the uptake of complement-coated particles and pathogens (PMID: 9558116; 20008295). CD11b\/CD18 is a receptor for the complement protein fragment iC3b, and is also a receptor for fibrinogen, factor X and ICAM1 (PMID: 2971974; 15485828).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Rheumatoid synovial cells and human monocytes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD11b (ICRF44)\nCalculated Molecular Weight: 1152 aa, 127 kDa\nGenBank Accession Number: BC096346\nGene Symbol: CD11b\nGene ID (NCBI): 3684\nENSEMBL Gene ID: ENSG00000169896\nRRID: AB_3673917\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCAGTCAATAGCTATCCCATATAAGAAA\nBarcode Sequence: CCAGTCAATAGCTAT\nForm: Liquid\nUNIPROT ID: P11215\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296087721,"sku":"G65116-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65116-1-5c","provider":"Iright","version":"1.0","type":"link"}