{"product_id":"proteintech-g65133-1-5c","title":"Proteintech, G65133-1-5C, MultiPro® 5CFLX Anti-Human CD3 (OKT3)","description":"Size: 10ug\nThe CD3 (G65133-1-5C) by Proteintech is a Monoclonal antibody targeting CD3 in Single Cell (Intra) applications with reactivity to Human samples\nG65133-1-5C targets CD3 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD3 is a multimeric protein associated with the T-cell receptor (TCR) to form a complex involved in antigen recognition and signal transduction (PMID: 15885124). CD3 is composed of CD3γ, δ, ε, and ζ chains (PMID: 1826255). It is expressed by thymocytes in a developmentally regulated manner, T cells, and some NK cells (PMID: 3289580). The TCR recognizes antigens bound to major histocompatibility complex (MHC) molecules. TCR-mediated peptide-MHC recognition is transmitted to the CD3 complex, leading to the intracellular signal transduction (PMID: 11985657).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG2a, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human T cells Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD3 (OKT3)\nCalculated Molecular Weight: 207 aa, 23 kDa\nGenBank Accession Number: BC049847\nGene Symbol: CD3\nGene ID (NCBI): 916\nENSEMBL Gene ID: ENSG00000198851\nRRID: AB_3673918\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCGGATAAGACCTTCCCCATATAAGAAA\nBarcode Sequence: TCGGATAAGACCTTC\nForm: Liquid\nUNIPROT ID: P07766\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297005225,"sku":"G65133-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65133-1-5c","provider":"Iright","version":"1.0","type":"link"}