{"product_id":"proteintech-g65186-1-5c","title":"Proteintech, G65186-1-5C, MultiPro® 5CFLX Anti-Human CD13 (WM15)","description":"Size: 10ug\nThe CD13 (G65186-1-5C) by Proteintech is a Monoclonal antibody targeting CD13 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65186-1-5C targets CD13 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD13, also named as APN, ANPEP (aminopeptidase N) or PEPN, is belongs to the peptidase M1 family. CD13 is a heavily glycosylated, ~150-240 kDa, type-II membrane, expressed by most cells of myeloid origin including monocytes, macrophages, granulocytes, and their hematopoietic precursors. It is also abundantly expressed in the brush border of epithelial cells from renal proximal tubules and small intestine, in prostatic epithelial cells, in bile duct canaliculi, in mast cells, and, in some cases, in fibroblasts and smooth muscle cells. CD13 is a multifunctional protein and plays varying roles in cell migration, cell proliferation, cell differentiation and so on. CD13 participates in angiogenesis generating and modulating angiogenic signals, and can be a marker of angiogenic vessels. CD13 is also a pan-myeloid marker, present on mature granulocytes and monocytes. (PMID: 8805662, 10098327, 18603472, 18097955, 17897790, 17888402, 21339174)\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human AML cells Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD13 (WM15)\nCalculated Molecular Weight: 110 kDa\nGenBank Accession Number: BC058928\nGene Symbol: CD13\nGene ID (NCBI): 290\nENSEMBL Gene ID: ENSG00000166825\nRRID: AB_3673927\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTAATGAGTAGAGCGCCCATATAAGAAA\nBarcode Sequence: TTAATGAGTAGAGCG\nForm: Liquid\nUNIPROT ID: P15144\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296218793,"sku":"G65186-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65186-1-5c","provider":"Iright","version":"1.0","type":"link"}