{"product_id":"proteintech-g65247-1-5c","title":"Proteintech, G65247-1-5C, MultiPro® 5CFLX Anti-Human CD226 (11A8)","description":"Size: 10ug\nThe CD226 (G65247-1-5C) by Proteintech is a Monoclonal antibody targeting CD226 in Single Cell (Intra) applications with reactivity to Human samples\nG65247-1-5C targets CD226 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD226 (DNAM-1) is a ~65 kDa glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. CD226 mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Interactions of CD226 and its ligands, CD155 and CD112, induce NK and T cell-mediated cytotoxicity and cytokine secretion (PMID: 15039383).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human NK Cells Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD226 (11A8)\nCalculated Molecular Weight: 336 aa, 39 kDa\nGenBank Accession Number: BC074787\nGene Symbol: CD226\nGene ID (NCBI): 10666\nENSEMBL Gene ID: ENSG00000150637\nRRID: AB_3673938\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTACTTATACGGAACCCATATAAGAAA\nBarcode Sequence: ATTACTTATACGGAA\nForm: Liquid\nUNIPROT ID: Q15762\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296775849,"sku":"G65247-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65247-1-5c","provider":"Iright","version":"1.0","type":"link"}