{"product_id":"proteintech-g65254-1-5c","title":"Proteintech, G65254-1-5C, MultiPro® 5CFLX Anti-Human CD35 (E11)","description":"Size: 10ug\nThe CD35 (G65254-1-5C) by Proteintech is a Monoclonal antibody targeting CD35 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65254-1-5C targets CD35 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD35, also known as complement receptor type 1 (CR1) or C3b\/C4b receptor, is a single-chain glycoprotein consisting of 30 repeating homologous protein domains known as short consensus repeats (~60 amino acids each) followed by transmembrane and cytoplasmic domains (PMID: 8765013). CD35 is variably expressed by granulocytes, monocytes, B cells, some T cells, erythrocytes, follicular dendritic cells, Langerhans cells, and glomerular podocytes (PMID: 19004497). CD35 acts as a receptor for C3b and C4b and plays important roles in the regulation of the complement cascade and clearance of immune complexes.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human CD35 from Acute monocytic leukemia cells and normal blood monocytes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD35 (E11)\nCalculated Molecular Weight: 224 kDa\nGenBank Accession Number: NM_000573\nGene Symbol: CR1\nGene ID (NCBI): 1378\nENSEMBL Gene ID: ENSG00000203710\nRRID: AB_3673940\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGAATGAATTGGATTCGCCCATATAAGAAA\nBarcode Sequence: AATGAATTGGATTCG\nForm: Liquid\nUNIPROT ID: P17927\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297136297,"sku":"G65254-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g65254-1-5c","provider":"Iright","version":"1.0","type":"link"}