{"product_id":"proteintech-g80084-1-5c","title":"Proteintech, G80084-1-5C, MultiPro® 5CFLX Anti-Human Phospho-Beta Catenin (Ser675) (6D6)","description":"Size: 10ug\nThe Phospho-Beta Catenin (Ser675) (G80084-1-5C) by Proteintech is a Recombinant antibody targeting Phospho-Beta Catenin (Ser675) in Single Cell (Intra) applications with reactivity to Human samples\nG80084-1-5C targets Phospho-Beta Catenin (Ser675) in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nβ-Catenin, also known as CTNNB1, is an evolutionarily conserved, multifunctional intracellular protein. β-Catenin was originally identified in cell adherens junctions (AJs) where it functions to bridge the cytoplasmic domain of cadherins to a-catenin and the actin cytoskeleton. Besides its essential role in the AJs, β-catenin is also a key downstream component of the canonical Wnt pathway that plays diverse and critical roles in embryonic development and adult tissue homeostasis. The Wnt\/β-catenin pathway is also involved in the activation of other intracellular messengers such as calcium fluxes, JNK, and SRC kinases. Deregulation of β-catenin activity is associated with multiple diseases including cancers. (PMID: 22617422; 18334222). PKA was shown to phosphorylate β-catenin at Ser675. Phosphorylation at Ser675 induces β-catenin accumulation in the nucleus and increases its transcriptional activity.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Rabbit \/ IgG\nClass: Oligo Conjugate\nType: Recombinant\nImmunogen: Peptide Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human Phospho-Beta Catenin (Ser675) (6D6)\nCalculated Molecular Weight: 781 aa, 86 kDa\nGenBank Accession Number: BC058926\nGene Symbol: Beta Catenin\nGene ID (NCBI): 1499\nENSEMBL Gene ID: ENSG00000168036\nRRID: AB_3673975\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGATATCTTAATCCGAACCCATATAAGAAA\nBarcode Sequence: ATATCTTAATCCGAA\nForm: Liquid\nUNIPROT ID: P35222\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888786755753,"sku":"G80084-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g80084-1-5c","provider":"Iright","version":"1.0","type":"link"}