{"product_id":"proteintech-g81042-1-5c","title":"Proteintech, G81042-1-5C, MultiPro® 5CFLX Anti-Human Lamin A\/C (5I16)","description":"Size: 10ug\nThe Lamin A\/C (G81042-1-5C) by Proteintech is a Recombinant antibody targeting Lamin A\/C in Single Cell (Intra) applications with reactivity to Human samples\nG81042-1-5C targets Lamin A\/C in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nLamin A\/C is also named as LMNA, or LMN1. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. The lack of lamin A\/C can be as a novel marker for undifferentiated embryonic stem cells and lamin A\/C expression is as an early indicator of differentiation (PMID: 16179429). Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. This protein has 4 isoforms produced by alternative splicing with the molecular weight of 74 kDa, 65 kDa, 70 kDa and 64 kDa. This antibody can recognize 4 isoforms of Lamin A\/C.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Rabbit \/ IgG\nClass: Oligo Conjugate\nType: Recombinant\nImmunogen: CatNo: Ag0408 Product name: Recombinant human Lamin A\/C protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 26-198 aa of BC003162 Sequence: ITRLQEKEDLQELNDRLAVYIDRVRSLETENAGLRLRITESEEVVSREVSGIKAAYEAELGDARKTLDSVAKERARLQLELSKVREEFKELKARNTKKEGDLIAAQARLKDLEALLNSKEAALSTALSEKRTLEGELHDLRGQVAKLEAALGEAKKQLQDEMLRRVDAENRLQ Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human Lamin A\/C (5I16)\nCalculated Molecular Weight: 65 kDa\nGenBank Accession Number: BC003162\nGene Symbol: Lamin A\/C\nGene ID (NCBI): 4000\nENSEMBL Gene ID: ENSG00000160789\nRRID: AB_3673977\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGAAGTGGAGTGTGTCTCCCATATAAGAAA\nBarcode Sequence: AAGTGGAGTGTGTCT\nForm: Liquid\nUNIPROT ID: P02545\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888786624681,"sku":"G81042-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/products\/proteintech-g81042-1-5c","provider":"Iright","version":"1.0","type":"link"}