BD, 940426, BD™ AbSeq Oligo Rat Anti-Mouse TIM-2

Alternative Name: T-cell membrane protein 2; Tim-2; Tim2; TIMD-2; Timd2
Entrez Gene ID: 171284
Vol. Per Test: 2 µl
Isotype: Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Reactivity: Mouse (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: AGTGGTGATGAGCGCAAGGGTGTTATTCGATGTGTC
Sequence ID: AMM2184
Immunogen: Mouse TIM-2 Recombinant Protein
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Rat
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.