Iright
BRAND / VENDOR: Thermo Fisher

Thermo Fisher, EP011SKB008C, TheraPure™ GMP T7 RNA Polymerase (200 U/μL)

CATALOG NUMBER: EP011SKB008C
Normaler Preis$0.99
/
  • ddddd

    99 xxxxxx

  • Nachbestellt, bald verfügbar

Diese Website ist durch hCaptcha geschützt und es gelten die allgemeinen Geschäftsbedingungen und Datenschutzbestimmungen von hCaptcha.

Product Description

TheraPure™ GMP T7 RNA Polymerase (200 U/μL) Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package. It is designed for synthesis of mRNA in the development and manufacturing of mRNA therapeutics and vaccines. As an DNA-dependent RNA polymerase, it synthesizes RNA 5'→3' from linear DNA containing the T7 promoter (TAATACGACTCACTATAGGGAGA).
Designed for process development and manufacturingTheraPure GMP T7 RNA Polymerase helps accelerate mRNA vaccine and therapeutics production from preclinical development to commercialization by providing:Quality—meet critical product quality needs to help accelerate therapeutic development and manufacturingMinimal risk—help reduce risks in developing therapeutics by utilizing proven productsTechnical partnership—partner with expert product and technical supportSecure and consistent supply—count on a secure and stable supply of product at a global scaleComprehensive quality systemTheraPure GMP T7 RNA Polymerase is supported by a extensive quality system and documentation including:Manufactured to relevant ICH Q7 GMP guidelinesAnimal-origin free (AOF) manufacturing processes, materials, and facilitiesValidated manufacturing processes and analytical test methodsComprehensive impurity profilesVerified compendial assays where applicableProduct stability dataTested by analytical methods following ICH Q2 guidelines whenever possibleDrug master file (DMF)Enzyme activityOne unit of enzyme incorporates 1 nmol of AMP into a polynucleotide fraction in 60 minutes at 37°C.
For additional TheraPure GMP products or customization, please visit www.
thermofisher.
cn/therapure.*TheraPure GMP refers to the quality level of the raw, ancillary, or starting materials to be used for further manufacturing. TheraPure GMP products are manufactured in facilities with ISO 9001–certified quality management systems that operate in accordance with relevant good manufacturing practice (GMP) principles, as outlined in ICH Q7 or equivalent guidance documents or standards.
Concentration: 200 U/μL
For Use With (Application): IVT Transcription, RNA Synthesis, mRNA Synthesis
Mass: 99 kDa
Quantity: 200 kU
Source: Bacteriophage T7
Storage Buffer: 25 mM HEPES-NaOH, pH 7.
6, 0.
1 mM EDTA-Na2, 150 mM NaCl, 10 mM DTT, 0.
09% Triton X-100, 50% glycerol
Polymerase: T7 RNA Polymerase
Product Line: TheraPure™ GMP
Promoter: T7
pH Range: 7.
2 to 8
Unit Size: Each


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924