BRAND / VENDOR: BD

BD, 940212, BD™ AbSeq Oligo Mouse Anti-Human CD371 (Clec12A)

CATALOG NUMBER: 940212

Normaler Preis$0.99
/
  • 99 Artikel übrig
  • Nachbestellt, bald verfügbar

Diese Website ist durch hCaptcha geschützt und es gelten die allgemeinen Geschäftsbedingungen und Datenschutzbestimmungen von hCaptcha.

Product Description

Alternative Name: CD371; Clec12A; MICL; CLL-1; DCAL-2
Entrez Gene ID: 160364
Vol. Per Test: 2 µl
Isotype: Mouse BALB/c IgG2a, κ
Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: TTTGCGTAGGTAGCGTATTGAATCGTTTGGTGTCTT
Sequence ID: AHS0097
Immunogen: Human CLEC12A Transfected Cell Line
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Order Guidelines

1. Price & Stock Available on Request. Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmtaion.

3. Minimum order value of $1,000 USD required.

4. 100% prepayment required.

Collaboration

Tony Tang

Email: Tony.Tang@iright.com

Mobile/WhatsApp/Wechat: +86-17717886924