BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO115, M13/pUC Reverse Sequencing Primer (-46), 24-mer

CATALOG NUMBER: SO115

Normaler Preis$0.99
/
  • 99 Artikel übrig
  • Nachbestellt, bald verfügbar

Diese Website ist durch hCaptcha geschützt und es gelten die allgemeinen Geschäftsbedingungen und Datenschutzbestimmungen von hCaptcha.

Product Description

Thermo Fisher, SO115, M13/pUC Reverse Sequencing Primer (-46), 24-mer Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such aspUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCRPrimer Sequence:5'-d(GAGCGGATAACAATTTCACACAGG)-3'For Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM, 42 μL
Shipping Condition: Dry Ice
Vector: pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Concentration: 10 μM
Primer: M13
Unit Size: 10 µM

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924