BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO511, pJET1.2 Reverse Sequencing Primer, 24-mer

CATALOG NUMBER: SO511

Preço normal$0.99
/
Frete calculado no checkout.
  • 99 em estoque
  • Inventory no caminho

Este site é protegido por hCaptcha e a Política de privacidade e os Termos de serviço do hCaptcha se aplicam.

Product Description

Thermo Fisher, SO511, pJET1.
2 Reverse Sequencing Primer, 24-mer Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.
2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.
2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.
2p sequence
• Colony screening by PCRpJET1.
2 Primer sequences
• pJET1.
2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.
2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'Related productspJET1.
2 Forward Sequencing Primer, 23-merFor Use With (Application): Sequencing
Form: Liquid
Product Type: Forward Sequencing Primer
Quantity: 10 μM, 84 μL
Shipping Condition: Dry Ice
Vector: pJET1.
2
Concentration: 10 μM
Primer: pJET
Unit Size: 10 µM

Order Guidelines

1. Price & Stock Available on Request. Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmtaion.

3. Minimum order value of $1,000 USD required.

4. 100% prepayment required.

Collaboration

Tony Tang

Email: Tony.Tang@iright.com

Mobile/WhatsApp/Wechat: +86-17717886924