Thermo Fisher, EP0113, T7 RNA Polymerase, HC (200 U/μL)

T7 RNA Polymerase, HC (200 U/μL) Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Highlights
• Incorporates modified nucleotides (e.
g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)ApplicationsSynthesis of unlabeled and labeled RNA that can be used:
• For hybridization,in vitroRNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicingConsensus promoter sequence:T7: TAATACGACTCACTATAGGGAGAConcentration: >200U/µL
Quantity: 25,000 units
Polymerase: T7 RNA Polymerase
Unit Size: Each