Iright
BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO120, T3 promoter Sequencing Primer, 24-mer

CATALOG NUMBER: SO120
Prix régulier$0.99
/
Frais d'expédition calculés lors du passage à la caisse.
  • ddddd

    99 xxxxxx

  • En rupture de stock, expédition prochainement

Ce site est protégé par hCaptcha, et la Politique de confidentialité et les Conditions de service de hCaptcha s’appliquent.

Product Description

Thermo Fisher, SO120, T3 promoter Sequencing Primer, 24-mer Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such aspTZ19R, pTZ57R, and pBluescript IIPromoter Sequence5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'Related productsSP6 promoter Sequencing Primer, 18-merT3 promoter Sequencing Primer, 17-merSP6 promoter Sequencing Primer, 24-merT7 promoter Sequencing Primer, 20-merNotes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylatedFor Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM, 42 μL
Shipping Condition: Dry Ice
Concentration: 10 μM
Primer: T3
Promoter: SP6, T3, T7
Unit Size: 10 µM


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924