BRAND / VENDOR: BD

BD, 940157, BD™ AbSeq Oligo Hamster Anti-Mouse CD27

CATALOG NUMBER: 940157

Prix régulier$0.99
/
Frais d'expédition calculés lors du passage à la caisse.
  • En stock
  • En rupture de stock, expédition prochainement

Ce site est protégé par hCaptcha, et la Politique de confidentialité et les Conditions de service de hCaptcha s’appliquent.

Product Description

Alternative Name: Tnfrsf7; Tumor necrosis factor receptor superfamily member 7; Tp55; S152
Entrez Gene ID: 21940
Vol. Per Test: 2 µl
Isotype: Armenian Hamster IgG1, κ
Reactivity: Mouse (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: AGTCGCTAATCGTGGTAAATCATATAAGGGTTCGGG
Sequence ID: AMM2053
Immunogen: Armenian hamster fibroblast line ARHO12 transfected with mouse Cd27 cDNA
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Armenian Hamster
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Product Notices: Product Notices This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Please refer to bd.com/genomics-resources for technical protocols. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Source of all serum proteins is from USDA inspected abattoirs located in the United States. Illumina is a trademark of Illumina, Inc. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). For U.S. patents that may apply, see bd.com/patents.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924