Product Description
Alternative Name: Cd84; CDw84; SLAM family member 5; SLAMF5
Entrez Gene ID: 12523
Vol. Per Test: 2 µl
Isotype: Rat IgG1, κ
Reactivity: Mouse (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: TAGTGTTGGCGCGGTAATTTAAGAGTCGATGGAAGT
Sequence ID: AMM2237
Immunogen: Mouse CD84 Recombinant Protein
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Rat
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmtaion.
3. Minimum order value of $1,000 USD required.
4. 100% prepayment required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924