BRAND / VENDOR: BD

BD, 940528, BD® AbSeq Oligo Mouse Anti-Biotin

CATALOG NUMBER: 940528

Prix régulier$0.99
/
Frais d'expédition calculés lors du passage à la caisse.
  • En stock
  • En rupture de stock, expédition prochainement

Ce site est protégé par hCaptcha, et la Politique de confidentialité et les Conditions de service de hCaptcha s’appliquent.

Product Description

Vol. Per Test: 2 µl/test
Isotype: Mouse IgG1, κ
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: ATTAGGTTTCAGGCGGTCGGGAGAGTGTATGTCAGT
Sequence ID: AHS0533
Immunogen: Biotin-conjugated Keyhole Limpet Hemocyanin (KLH)
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any contents in the cap/tube threads prior to the first opening. Definitions: Primary antibody: Antibody directly binds to target protein epitope Secondary antibody: This antibody binds to primary antibody Because the target for this antibody can vary depending on the primary target, it is recommended to optimize the antibody concentration before use by following the Flow Cytometry Analysis of BD™ AbSeq Ab-Oligo and Sample Tag Expression Protocol (Doc ID: 232502 Rev. 2.0. see https://www.bdbiosciences.com/content/dam/bdb/marketing-documents/BD-AbSeq-Ab-Oligo-Flow-Cytometry-Analysis-User-Guide.pdf ). The starting concentration for this antibody is 0.5 µg/µL and dilution may be necessary to maximize signal to noise because the antibody amount depends on the concentration of the primary antibody. Staining Protocol 1)  (Optional) Treat cells with Fc Block a.  Make Fc Block mix by combining 114 µL BD Pharmingen™ Stain Buffer (FBS) with 6 µL BD Human or Mouse Fc Block (PN 564220 or      553142, respectively) and mix thoroughly by pipetting. b.  Pellet cells by centrifuging at 400 x g for 5 minutes. Decant supernatant. c.  Add 110 µL Fc Block mix to cell pellet d.  Incubate cells at room temperature for 10 minutes. 2)  Stain with primary antibody a.  Make primary antibody mix by combining optimal volume of primary antibody (see primary antibody product technical data sheet) with 98 µL BD Pharmingen™ Stain Buffer (FBS) and mix thoroughly by pipetting. b.  Transfer 100 µL of cell-containing suspension to primary antibody mix, for a total staining volume of 200 µL. c.  Incubate for 30-60 minutes on ice. d.  (Note: During this incubation it is recommended to pool the secondary AbSeq antibody with any additional AbSeq to be included in the assay. See one of the BD Rhapsody System Single-Cell Labeling with the BD® AbSeq Ab-Oligos protocols listed in step 3a for guidance). e.  Add 2 mL BD Pharmingen™ Stain Buffer (FBS) and mix gently by pipetting, avoiding bubbles. f.  Pellet cells by centrifuging at 400 x g for 5 minutes. Decant supernatant. g.  Repeat steps d-e 2x for a total of 3 washes. h.  After the third wash, suspend cells in 100 µL BD Pharmingen™ Stain Buffer (FBS). 3)  Stain with secondary antibody a.  Stain cells with the AbSeq pool prepared during the incubation step C, referring to one of the AbSeq protocols below as needed. • Single-Cell Labeling with BD® AbSeq Ab-Oligos (41 to 100 plex) (Doc ID: 23-22314) • Single Cell Labelling with BD® Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (1 to 40 plex) (Doc ID:23-21339) • Single-Cell Labeling with BD® Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (41 to 100 plex) (Doc ID: 23-22354) • Single-Cell Labeling with BD® Flex Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (1 plex to 100 plex) (Doc ID:23-24312) Sequencing reference files can be made using the BD® AbSeq Panel Reference Generator (https://abseq-ref-gen.genomics.bd.com/ ). Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bdscomix.bd.com. Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.
Product Notices: Product Notices Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction. For best results, close caps securely after use and before storage. Source of all serum proteins is from USDA inspected abattoirs located in the United States. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). For U.S. patents that may apply, see bd.com/patents.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924