BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO117, SP6 promoter Sequencing Primer, 24-mer

CATALOG NUMBER: SO117

Prix régulier$0.99
/
Frais d'expédition calculés lors du passage à la caisse.
  • 99 en stock
  • En rupture de stock, expédition prochainement

Ce site est protégé par hCaptcha, et la Politique de confidentialité et les Conditions de service de hCaptcha s’appliquent.

Product Description

Thermo Fisher, SO117, SP6 promoter Sequencing Primer, 24-mer Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such aspTZ19R, pTZ57R, and pBluescript IIPromoter Sequence:5'-d (CATACGATTTAGGTGACACTATAG)-3'Related productsSP6 promoter Sequencing Primer, 18-merT7 promoter Sequencing Primer, 20-merT3 promoter Sequencing Primer, 17-merT3 promoter Sequencing Primer, 24-merNotes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylatedFor Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM, 42 μL
Shipping Condition: Dry Ice
Vector: pTZ19R, pTZ57R, pBluescript II
Concentration: 10 μM
Primer: SP6
Promoter: SP6, T3, T7
Unit Size: 10 µM

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924