BRAND / VENDOR: BD

BD, 940524, BD® AbSeq Oligo Mouse IgG1, κ Isotype Control

CATALOG NUMBER: 940524

Preço normal$0.99
/
Frete calculado no checkout.
  • Em estoque
  • Inventory no caminho

Este site é protegido por hCaptcha e a Política de privacidade e os Termos de serviço do hCaptcha se aplicam.

Product Description

Alternative Name: IgG1, kappa Isotype Control (Anti-KLH)
Vol. Per Test: 2 µl/test
Isotype: Mouse BALB/c IgG1, κ
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: TAATGGAGGTAGGCTTGCGTATGAGTTTCGGCGTTT
Sequence ID: AHS0493
Immunogen: Keyhole limpet hemocyanin (KLH)
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 g to ensure removal of any contents in the cap/tube threads prior to the first opening. Please refer to the following CITE-Seq protocols for additional staining instructions: • Single Cell Labelling with BD® AbSeq Ab-Oligos (1 to 40-plex) (Doc ID: 23-24262) • Single-Cell Labeling with BD® AbSeq Ab-Oligos (41 to 100 plex) (Doc ID: 23-22314) • Single Cell Labelling with BD® Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (1 to 40 plex) (Doc ID:23-21339) • Single-Cell Labeling with BD® Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (41 to 100 plex) (Doc ID: 23-22354) • Single-Cell Labeling with BD® Flex Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (1 plex to 100 plex) (Doc ID:23-24312) Sequencing reference files can be made using the BD® AbSeq Panel Generator (https://abseq-ref-gen.genomics.bd.com/ ). Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bd.com. Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.
Product Notices: Product Notices Source of all serum proteins is from USDA inspected abattoirs located in the United States. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). For U.S. patents that may apply, see bd.com/patents. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction. For best results, close caps securely after use and before storage. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924