Iright
BRAND / VENDOR: BD

BD, 572435, BD® OMICS-One APC/Myeloid-Cell Protein Panel

CATALOG NUMBER: 572435
Обычная цена$0.99
/
/ru/policies/shipping-policy '>Стоимость доставки рассчитывается при оформлении заказа.
  • ddddd

    99 xxxxxx

  • Под заказ, отправка скоро

Этот веб-сайт защищается hCaptcha. Применяются Политика конфиденциальности и Условия использования hCaptcha.

Product Description

Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Regulatory Status: RUO
Description: Description The BD ® OMICS-One APC/Myeloid-Cell Protein Panel consists of 30 different specificities against major APC/Myeloid-Cell markers in a single tube. Designed and optimized to work on the BD Rhapsody™ System, the APC/Myeloid-Cell Protein Panel is tested to work seamlessly alongside the BD Rhapsody™ Whole Transcriptome Analysis (WTA) Assay, Targeted mRNA Assay, BD ® Single-Cell Multiplexing Kit (SMK), BD ® Intracellular CITE-seq (IC-AbSeq) Assay, and BD Rhapsody™ TCR/BCR Next Multiomic Assay for human. The individual antibodies were each conjugated to an oligonucleotide that contains a specific antibody barcode sequence flanked by a polyA tail on the 3' end and a common PCR handle (PCR primer binding site) on the 5' end. All AbSeq barcode sequences were generated in-silico with minimal sequence similarity to the human genomes, have low predicted secondary structure, and have high Hamming distance within the BD antibody-oligo portfolio, to allow for sequencing error correction and unique mapping. The polyA tail of the oligonucleotide allows the barcode sequence to be captured by BD Rhapsody™ Enhanced Cell Capture Beads. The 5' PCR handle allows for efficient library generation for various sequencing platforms. Each individual antibody exists at an optimal concentration within the 30-plex to enable superior target and population resolution. The APC/Myeloid-Cell Protein Panel is designed with SMART technology. SMART technology helps lower sequencing cost while increasing data resolution by attenuating antibodies that target high-expressing primary markers and allowing reallocation of sequencing reads to markers expressed at lower levels. With SMART technology, markers low in expression can be quantified without having to do deeper sequencing and incurring high sequencing cost. The two specificities attenuated in the APC/Myeloid-Cell Protein Panel are CD45 and HLA-DR.
Preparation And Storage: Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
Recommended Assay Procedures: This reagent is provided lyophilized in a pre-titrated format. 1. Remove the BD ® OMICS-One APC/Myeloid-Cell Protein Panel tube from the foil bag and bring up to room temperature for 5 minutes. 2. Make sure the pellet is located at the bottom of the tube. If not, briefly centrifuge to collect the contents at the tube bottom. 3. Add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Place the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibody immediately before cell staining. Prolonged incubation of reconstituted antibody may increase the non-specific background. 5. For BD ® AbSeq Ab-Oligo drop-in of 60 plex or lower, prepare the BD ® AbSeq labeling MasterMix in 1.5-mL LoBind tube on ice. Note: For drop-in with more than 60 plex, reach out to technical support for calculation. If sequential labeling with Sample Tags or no Sample Tags, prepare BD ® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        140 – (2.0 x N)     182 – (2.6 x N)     364 – (5.2 x N) Total                               140                 182                 364 If  co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        120 – (2.0 × N)     156 – (2.6 × N)     312 – (5.2 × N) Total                               120                 156                 312 *  N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. †  FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD ® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. If sequential labeling with Sample Tags or no Sample Tags, for each sample, add 140 μL BD ® AbSeq labeling MasterMix of drop-ins to the tube containing 35 μL reconstituted APC/Myeloid-Cell Protein Panel solution to make a total volume of 175 μL If co-labeling with Sample Tags, for each sample, add 120 μL BD ® AbSeq labeling MasterMix of drop-ins and 20 μL Sample Tag to the tube containing 35 μL reconstituted APC/Myeloid-Cell Protein Panel solution to make a total volume of 175 μL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. If Fc Block is not used, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (catalog number 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component                           1 sample (µL)*    1 sample + 20% overage (µL) FBS† (catalog number 554656)        20.0              24.0 Fc Block‡ (catalog number 564220)   5.0               6.0 Total                               25.0              30.0 *  Sufficient for up to 1 million cells. To block more cells, adjust the volume. †  FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block =  BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 μL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 μL of BD ® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 μL Stain Buffer (FBS) to the 175 μL of BD ® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 μL. Resuspend the cell pellet in 200 μL total volume. Pipet-mix. 12. Transfer the cells with BD ® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3-4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 × g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove  residual supernatant from tube rim. 17. Repeat steps 14 – 16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. Refer to the BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8-minute incubation) as described in the following sub-steps. a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. P lace the cartridge on the BD Rhapsody™ HT Xpress and perform the On-Cartridge Wash steps as follows: _____________________________________________________________ Material to load        Volume (µL) 1 lane      Pipette Mode Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One T-Cell panel: ______________________________________________________________________________ Specificity     Clone       Oligo ID     BD® AbSeq Barcode Sequence___________ CD103           BER-ACT     AHS0001      AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT CD274 (PD-L1)   MIH1        AHS0004      ATCGTAAGGCTCGTGGTTCGTAAGTAAGTTCGTATC CD11b           M1/70       AHS0005      ATCGTTATTCGTTGTAGTTCGCCCGGTTTGAGTAGT CD123           7G3         AHS0020      ACAGTTTAGTAGGACGTGAGGTATCGCGAGAATGCC HLA-DR          G46-6       AHS0035      TGTTGGTTATTCGTTAGTGCATCCGTTTGGGCGTGG CD14            MPHIP9      AHS0037      TGGCCCGTGGTAGCGCAATGTGAGATCGTAATAAGT CD45            HI30        AHS0040      GTGCGAAATGGCGGAATGTTATCTGCGAATGTAGTC CD33            WM53        AHS0044      GTGTTAGTGATTTGATAGGACGCGTTACGAGAGATT CD80            L307.4      AHS0046      GAGGGTAACGGGTGTCCAAATATCGGCTGTGTAAGT CD16            3G8         AHS0053      TAAATCTAATCGCGGTAACATAACGGTGGGTAAGGT CD64            10.1        AHS0055      TTGTGCGGCGTAGTATGGTTATCTCGAGTGAAAGTC CD11c           B-LY6       AHS0056      ATGCGTTGCGAGAGATATGCGTAGGTTGCTGATTGG CD163           GHI/61      AHS0062      TATTATGTGCGAACTATGGTATCCGTATTGAGGGCT CD195 (CCR5)    2D7/CCR5    AHS0070      ATGGTTTAGTCGTACGTGGGTTTAGATTGGCGGTGC CD206           19.2        AHS0072      GCTGGTTATCGTTTGAGAGTCGGTATGGAATGCGGT CD32            FLI8.26     AHS0073      GGTTGTAGGTGCGGAATATAAGCGTCGTTGAGGTGT CD273           MIH18       AHS0075      TGAGTAACCGTATGTAATCCGTAATCGTAGAAGCGC CD141           1A4         AHS0083      TGGAAGTAAGTATGGGTCGGCGTAAATTGTGCGTGT CD1             F10/21A3    AHS0088      ATAGATTACATTCGTTTAGCGTTGGGTTCGGTCCGT CD40            5C3         AHS0117      GGTGTAATTGGGCTAGAACGTATATGCGGTAAGGCG FCeR1a          AER-37      AHS0129      GATATGGCGTGATGGTAGGTTCGGTTTAAGTTAGCG CD169           7-239       AHS0133      CATTAAGCACGAAGGGTATAGGTAGGAACGGTTGGC CD36            IVC7        AHS0135      AATTGTAGTAGTCCGGTGTATGTAGAGTAGGCGTTT CD115 (CSF1R)   9-4D2-1E4   AHS0136      CTGGTGGCGGCGAATTTGGTTACGACATATAGGGTT CD162           KPL-1       AHS0139      CCAGATAGGCGATAGTGTTTAGGAGCGATTAGTGTG CD85K           ZM3.8       AHS0179      AGTAGTCGTAGTTGGCGTGAATTGGGCTTATATCTG VISTA           MIH65.RMAB  AHS0187      ATCAGGGAATCTCGGTAAGTTAAACGTGTATAGTGC CD15            W6D3        AHS0196      ATAGGCATGGACGACGTAGATAATAAGTGGCGGGTT CD192 (CCR2)    LS132.1D9   AHS0208      CATGAGTGAGGCGATATAGTGAGCGGTTTGTAGATT CD116           Hgmcsfr1-M1 AHS0238      CTTAGTTGTAGGATCGAGAGTAGGTGTGCATTGCGT_
Product Notices: This reagent is provided lyophilized in a pre-titrated format. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Go to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. Source of all serum proteins is from USDA inspected abattoirs located in the United States. For U.S. patents that may apply, see bd.com/patents. Read and understand the safety data sheets (SDSs) before handling chemicals.To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bd.com.
Tables: Description: Quantity/Size: Quantity/Size Part Number: Part Number EntrezGene ID: EntrezGene ID
Description: Quantity/Size: 1.0 Part Number: N/A EntrezGene ID: N/A


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924


Вам также может понравиться