BD, 940196, BD™ AbSeq Oligo Mouse Anti-Mouse Vß 5.1, 5.2 T-Cell Receptor

Alternative Name: TCR Vβ5.1/5.2; Vβ5 T-cell receptor; T cell receptor beta 5
Entrez Gene ID: 21577
Vol. Per Test: 2 µl
Isotype: Mouse SWR IgG1, κ
Reactivity: Mouse (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: AGGGTAGTGTTGTAGACGTGTGCGGTAAGGATAAGG
Sequence ID: AMM2092
Immunogen: Mouse T-Cell Hybridoma 2HB51.8
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.