Iright
BRAND / VENDOR: BD

BD, 940495, BD™ AbSeq Oligo Mouse Anti-Mouse Ly-49H

CATALOG NUMBER: 940495
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Alternative Name: Ly49h; Lymphocyte antigen 49H; Klra8; Cmv1; Cmv-1
Entrez Gene ID: 16639
Vol. Per Test: 2 µl
Isotype: Mouse BALB/c IgG1, κ
Reactivity: Mouse (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: ATGTGGCGACGATGACTTATGAGGTATTATGCTTTC
Sequence ID: AMM2265
Immunogen: Mouse Ly-49A/H Transfected Cell Line
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Product Notices: Product Notices This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction. Source of all serum proteins is from USDA inspected abattoirs located in the United States. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Illumina is a trademark of Illumina, Inc. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). Please refer to bd.com/genomics-resources for technical protocols. For U.S. patents that may apply, see bd.com/patents.


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924