Iright
BRAND / VENDOR: Thermo Fisher

Thermo Fisher, EP0113, T7 RNA Polymerase, HC (200 U/μL)

CATALOG NUMBER: EP0113
Prix régulier$0.99
/
Frais d'expédition calculés lors du passage à la caisse.
  • ddddd

    99 xxxxxx

  • En rupture de stock, expédition prochainement

Ce site est protégé par hCaptcha, et la Politique de confidentialité et les Conditions de service de hCaptcha s’appliquent.

Product Description

T7 RNA Polymerase, HC (200 U/μL) Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Highlights
• Incorporates modified nucleotides (e.
g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)ApplicationsSynthesis of unlabeled and labeled RNA that can be used:
• For hybridization,in vitroRNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicingConsensus promoter sequence:T7: TAATACGACTCACTATAGGGAGAConcentration: >200U/µL
Quantity: 25,000 units
Polymerase: T7 RNA Polymerase
Unit Size: Each


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924