Product Description
40000 kU Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package. It is designed for synthesis of mRNA in the development and manufacturing of mRNA therapeutics and vaccines. As an DNA-dependent RNA polymerase, it synthesizes RNA 5'→3' from linear DNA containing the T7 promoter (TAATACGACTCACTATAGGGAGA).
Designed for process development and manufacturingTheraPure GMP T7 RNA Polymerase helps accelerate mRNA vaccine and therapeutics production from preclinical development to commercialization by providing:
•Quality—meet critical product quality needs to help accelerate therapeutic development and manufacturing
•Minimal risk—help reduce risks in developing therapeutics by utilizing proven products
•Technical partnership—partner with expert product and technical support
•Secure and consistent supply—count on a secure and stable supply of product at a global scaleComprehensive quality systemTheraPure GMP T7 RNA Polymerase is supported by a extensive quality system anddocumentationincluding:
• Manufactured to relevant ICH Q7 GMP guidelines
• Animal-origin free (AOF) manufacturing processes, materials, and facilities
• Validated manufacturing processes and analytical test methods
• Comprehensive impurity profiles
• Verified compendial assays where applicable
• Product stability data
• Tested by analytical methods following ICH Q2 guidelines whenever possible
• Drug master file (DMF)Enzyme activityOne unit of enzyme incorporates 1 nmol of AMP into a polynucleotide fraction in 60 minutes at 37°C.
For additional TheraPure GMP products or customization, please visitwww.
thermofisher.
cn/therapure.*TheraPure GMP refers to the quality level of the raw, ancillary, or starting materials to be used for further manufacturing. TheraPure GMP products are manufactured in facilities with ISO 9001–certified quality management systems that operate in accordance with relevant good manufacturing practice (GMP) principles, as outlined in ICH Q7 or equivalent guidance documents or standards.
Final Product Type: Liquid
Polymerase: T7 RNA Polymerase
Product Line: TheraPure™ GMP
Promoter: T7
For Use With (Application): IVT Transcription, RNA synthesis, mRNA synthesis
Quantity: 40000 kU
Concentration: 200 U/μL
Storage Buffer: 25 mM HEPES-NaOH, pH 7.
6, 0.
1 mM EDTA-Na2, 150 mM NaCl, 10 mM DTT, 0.
09% Triton X-100, 50% glycerol
Expression System: E. coli
Mass: 99 kDa
Source: Bacteriophage T7
pH Range: 7.
2 to 8.
0
Appearance: Transparent
Percent Purity: ≥95
Unit Size: Each
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmtaion.
3. Minimum order value of $1,000 USD required.
4. 100% prepayment required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924