Product Description
Thermo Fisher, SO115, M13/pUC Reverse Sequencing Primer (-46), 24-mer Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such aspUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCRPrimer Sequence:5'-d(GAGCGGATAACAATTTCACACAGG)-3'For Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM, 42 μL
Shipping Condition: Dry Ice
Vector: pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Concentration: 10 μM
Primer: M13
Unit Size: 10 µM
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmtaion.
3. Minimum order value of $1,000 USD required.
4. 100% prepayment required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924