Biolegend, 305915, TotalSeq™-D0940 anti-human CD116 Antibody, 10μg

CD116 is a 70-85 kD α chain of the GM-CSF receptor. It combines with CDw131 β chain to form the high affinity GM-CSF receptor. A soluble form of CD116, which binds GM-CSF with a relatively low affinity, has been identified. In addition, an alternatively spliced form of CD116 with an altered cytoplasmic tail has been described. CD116 is expressed on various myeloid cells including monocytes, macrophages, neutrophils, eosinophils, dendritic cells and their precursors, fibroblasts, and endothelial cells. CD116 is expressed on myeloid leukemias, osteogenic sarcoma cell lines, osteoblast-like cells and breast and lung carcinoma cell lines.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human GM-CSFRα transfected COS cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunoprecipitation2, Western blotting1, and immunohistochemical staining of acetone-fixed frozen tissue sections4 and paraffin-embedded tissue sections5.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna.The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Stomski FC, et al. 1998. J. Biol. Chem. 273:1192. (WB) McClure B, et al. 2001. Blood 98:3165. (IP) Guthridge MA, et al. 2004. Blood 103:820. Xiong S, et al. 2013. J. Clin. Invest. 123:4264. (IHC) Sawada H, et al. 2014. J. Exp. Med. 211:263. (IHC).
RRID: AB_2894574 (BioLegend Cat. No. 305915)
Structure: Ig superfamily, type I transmembrane glycoprotein, associates with CDw131, 70-85 kD
Distribution: Monocytes, granulocytes, dendritic cells, endothelial precursors
Function: Myeloid hematopoietic cell proliferation, differentiation
Ligand/Receptor: GM-CSF
Cell Type: Dendritic cells, Endothelial cells, Granulocytes, Monocytes
Biology Area: Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Miyajima A, et al. 1993. Blood 82:1960.
Gene ID: 1438
UniProt: View information about CD116 on UniProt.org
Clone: 4H1
Regulatory Status: RUO
Other Names: GM-CSFRα chain
Isotype: Mouse IgG1, κ
Barcode Sequence: ATGGACAGTTCGTGT