Iright
BRAND / VENDOR: Biolegend

Biolegend, 369339, TotalSeq™-D0152 anti-human CD223 (LAG-3) Antibody, 10μg

CATALOG NUMBER: 369339
السعر العادي$0.99
/
  • ddddd

    99 xxxxxx

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD223, also known as LAG-3, is a 70 kD type I transmembrane glycoprotein that is involved in T-cell signaling. Similar to CD4, CD223 binds MHC class II, but with a higher affinity. CD223 negatively regulates T-cell activation. It is expressed by activated T-cells and natural killer cells (NKs), as well as regulatory T-cells. It is transiently expressed on the surface of activated T-cells in acute conditions but high expression is maintained under tolerizing conditions. CD223 deficiency results in reduced tumor growth. CD223 and PD-1 can act in synergy and reverse exhausted phenotypes, improve tumor rejection, and control viral load.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human LAG-3 transfected cells.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The staining of clone 11C3C65 cannot be blocked by clone 7H2C65, which is another anti-human CD223 (LAG-3) antibody.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2892449 (BioLegend Cat. No. 369339)
Structure: 70 kD transmembrane glycoprotein, Ig superfamily, highly homologous to CD4.
Distribution: Activated T-cells and natural killer cells (NKs) and regulatory T cells.
Function: Negatively regulates T-cell activation.
Ligand/Receptor: Binds MHC class II molecules.
Cell Type: Dendritic cells, NK cells, T cells, Tregs
Biology Area: Immunology, Inhibitory Molecules
Molecular Family: CD Molecules, Immune Checkpoint Receptors
Antigen References: 1. Castelli C, et al. 2014. Oncoimmunology. 3(11):e967146. 2. Poirier N, et al. 2011. Clin. Exp. Immunol. 164:265. 3. Juno JA, et al. 2015. Retrovirology. 12:17. 4. Casati C, et al. 2006. Cancer Res. 66:4450.
Gene ID: 3902
UniProt: View information about CD223 on UniProt.org
Clone: 11C3C65
Regulatory Status: RUO
Other Names: CD223, LAG-3, LAG3, lymphocyte-activation gene-3
Isotype: Mouse IgG1, κ
Barcode Sequence: CATTTGTCTGCCGGT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924