Proteintech, G10366-1-5C, MultiPro® 5CFLX Anti-Human Vimentin (Polyclonal)

Size: 10ug The Vimentin (G10366-1-5C) by Proteintech is a Polyclonal antibody targeting Vimentin in Single Cell (Intra) applications with reactivity to Human samples G10366-1-5C targets Vimentin in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Vimentin, also named as VIM, belongs to the intermediate filament family. Vimentin is class-III intermediate filaments found in various non-epithelial cells, especially mesenchymal cells. Vimentin is important for stabilizing the architecture of the cytoplasm. Monocyte-derived macrophages secrete vimentin into the extracellular space in vitro. Secretion of vimentin was enhanced by the proinflammatory cytokine tumor necrosis factor-alpha (TNFA; 191160) and inhibited by the antiinflammatory cytokine IL10 (124092), suggesting that vimentin is involved in the immune response. Vimentin has specialized functions that contribute to specific dynamic cellular processes. As a phosphoprotein, 55-60 kDa of vimentin proteins can be observed due to the different phosphorylation level. Isoforms of vimentin (49 kDa and 60 kDa) had also been reported. (PMID: 8640945, 22728585). Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag0489 Product name: Recombinant human Vimentin protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 1-466 aa of BC000163 Sequence: MSTRSVSSSSYRRMFGGPGTASRPSSSRSYVTTSTRTYSLGSALRPSTSRSLYASSPGGVYATRSSAVRLRSSVPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHEEEIQELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESTEYRRQVQSLTCEVDALKGTNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPNFSSLNLRETNLDSLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human Vimentin (Polyclonal) Calculated Molecular Weight: 466 aa, 54 kDa GenBank Accession Number: BC000163 Gene Symbol: VIM Gene ID (NCBI): 7431 ENSEMBL Gene ID: ENSG00000026025 RRID: AB_3673880 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCCTAATCGTATTGCCCCATATAAGAAA Barcode Sequence: TCCTAATCGTATTGC Form: Liquid UNIPROT ID: P08670 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.