Proteintech, G65198-1-5C, MultiPro® 5CFLX Anti-Human CD21 (BU32)

Size: 10ug The CD21 (G65198-1-5C) by Proteintech is a Monoclonal antibody targeting CD21 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65198-1-5C targets CD21 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD21, also known as complement receptor type 2 (CR2), complement C3d receptor, and Epstein-Barr virus receptor, is a transmembrane protein that contains a small cytoplasmic domain, a transmembrane region and an extracellular domain consisting of 15 tandem short consensus repeat sequences (PMID: 6230668; 2551147). It is expressed on B cells, follicular dendritic cells, thymocytes and a subset of peripheral T cells (PMID: 26119182). CD21 binds complement fragments C3d, C3dg and iC3b and acts as a receptor for the Epstein-Barr virus (PMID: 7753047). On B cells, together with CD19 and CD81, CD21 forms a complex that functions as a co-receptor to the BCR (PMID: 7542009). It is involved in B cells activation and functions. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD21 (BU32) Calculated Molecular Weight: 1092 aa, 119 kDa GenBank Accession Number: BC136394 Gene Symbol: CD21 Gene ID (NCBI): 1380 ENSEMBL Gene ID: ENSG00000117322 RRID: AB_3673933 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCACAATAATGTCAACCCATATAAGAAA Barcode Sequence: CCACAATAATGTCAA Form: Liquid UNIPROT ID: P20023 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.