BD, 940097, BD™ AbSeq Oligo Mouse Anti-Human HVEM (CD270)

Alternative Name: TNFRSF14; HVEM; HVEA; LIGHTR ; ATAR ; TR2
Vol. Per Test: 2 µl
Isotype: Mouse IgG1, κ
Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: AACGATAGATTGCCGAAAGCGATAGAGATTGGAACG
Sequence ID: AHS0105
Immunogen: Human Recombinant Protein
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Product Notices: Product Notices This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Please refer to bd.com/genomics-resources for technical protocols. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Source of all serum proteins is from USDA inspected abattoirs located in the United States. Illumina is a trademark of Illumina, Inc. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). For U.S. patents that may apply, see bd.com/patents.