BRAND / VENDOR: BD

BD, 940515, BD® AbSeq Oligo Mouse Anti-T-bet

CATALOG NUMBER: 940515

Regular price$0.99
/
Shipping calculated at checkout.
  • 99 items in stock
  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Alternative Name: T-box expressed in T cells; TBX21; T-box 21; TBLYM
Entrez Gene ID: 30009, 57765
Vol. Per Test: 2 µl/test
Isotype: Mouse IgG1, κ
Reactivity: Human, Mouse (Tested in Development)
Barcode Sequence: TGTAAAGATGTCGGGCTATGGGTCAGTATGTATTGG
Sequence ID: AHS481
Immunogen: Human T-bet Peptide
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening. When using BD® AbSeq intracellular markers with the Single Cell 3' Sequencing Intracellular CITE-seq, cells must first be fixed and permeabilized using the BD Rhapsody™ Intracellular AbSeq Buffer Kit before the antibody-oligo can bind to the protein. Refer to the list of required companion products below and see BD Rhapsody™ System Single-Cell Labelling with BD® AbSeq Ab-Oligos for Intracellular CITE-seq (Doc ID: 23-24464) for the complete BD® AbSeq intracellular multiomics staining protocol. Contact your local Field Application Specialist (FAS) for additional guidance. Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bdscomix.bd.com. Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.

Order Guidelines

1. Price & Stock Available on Request. Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmtaion.

3. Minimum order value of $1,000 USD required.

4. 100% prepayment required.

Collaboration

Tony Tang

Email: Tony.Tang@iright.com

Mobile/WhatsApp/Wechat: +86-17717886924