Product Description
CD3ε is a 20 kD chain of the CD3/T-cell receptor (TCR) complex which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T-cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T cells, NKT cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.
10μg
Verified Reactivity: Human
Reported Reactivity: Chimpanzee
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4,6,7 and formalin-fixed paraffin-embedded sections11, immunoprecipitation1, activation of T cells2,3,5, Western blotting9, and spatial biology (IBEX)16,17. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300413, 300414, and 300432). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 300437, 300438, 300465, 300466, 300473, 300474) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Salmeron A, et al. 1991. J. Immunol. 147:3047. (IP) Graves J, et al. 1991. J. Immunol. 146:2102. (Activ) Lafont V, et al. 2000. J. Biol. Chem. 275:19282. (Activ) Ryschich E, et al. 2003. Tissue Antigens 62:48. (IHC) Thompson AG, et al. 2004. J. Immunol. 173:1671. (Activ) Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immun. 5:430. (IHC) Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC) Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed Van Dongen JJM, et al. 1988. Blood 71:603. (WB) Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Pollard, K. et al. 1987. J. Histochem. Cytochem. 35:1329. (IHC) Luckashenak N, et al. 2013. J. Immunol. 190:27. PubMed Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed Li J, et al. 2015. Cancer Res. 75:508. PubMed Stoeckius M, et al. 2017. Nat. Methods. 14:865-868. (PG) Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2892342 (BioLegend Cat. No. 300485)
Structure: Ig superfamily, with the subunits of CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) forms CD3/TCR complex, 20 kD
Distribution: Mature T and NK T cells, thymocyte differentiation
Function: Antigen recognition, signal transduction, T cell activation
Ligand/Receptor: Peptide antigen bound to MHC
Cell Type: NKT cells, T cells, Thymocytes, Tregs
Biology Area: Immunology, Innate Immunity
Molecular Family: CD Molecules, TCRs
Antigen References: 1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego. 2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329. 3. Lanier L, et al. 1986. J. Immunol. 137:2501-2507.
Gene ID: 916
UniProt: View information about CD3 on UniProt.org
Clone: UCHT1
Regulatory Status: RUO
Workshop: III 471
Other Names: T3, CD3ε
Isotype: Mouse IgG1, κ
Barcode Sequence: CTCATTGTAACTCCT
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924