Biolegend, 300647, TotalSeq™-D0138 anti-human CD5 Antibody, 10μg

CD5 is a 67 kD single chain type I glycoprotein also known as Leu-1, Ly-1 and T1. It is a member of the scavenger receptor superfamily found on T cells, thymocytes, B cell subsets, chronic B lymphocytic leukemia (B-CLL), and peripheral blood dendritic cells. CD5 modulates T and B cell receptor signaling, thymocyte maturation, and T-B cell interactions upon binding to ligands such as CD72.
10μg
Verified Reactivity: Human
Reported Reactivity: Chimpanzee, Capuchin Monkey, Common Marmoset, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: Western blotting2 and immunohistochemical staining of acetone-fixed frozen sections2,5.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Knapp W, et al. 1989. Leucocyte Typing IV Oxford University Press. New York. Renaudineau Y, et al. 2005. Blood 106:2781. (WB IHC) Porter JC and Hogg N. 1997. J. Cell Biol. 138:1437. Saliba AE, et al. 2010. P. Natl. Acad. Sci. USA 107:14524. PubMed Kap Y, et al. 2009. J. Histochem. Cytochem. 57:1159. (IHC)
RRID: AB_2892344 (BioLegend Cat. No. 300647)
Structure: Scavenger receptor superfamily, 67 kD
Distribution: T cells, thymocytes, B cell subset, B cell CLL, peripheral blood dendritic cells
Function: Modulates TCR, BCR signaling, thymocyte maturation, T-B cell interaction
Ligand/Receptor: CD72
Cell Type: B cells, Dendritic cells, Leukemia, T cells, Thymocytes
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Kipps T. 1988. Adv. Immunol. 47:117. 2. Resnick D, et al. 1993. Trends Biochem. Sci. 19:5. 3. Wood GS, et al. 1992. Am. J. Pathol. 14:789.
Gene ID: 921
UniProt: View information about CD5 on UniProt.org
Clone: UCHT2
Regulatory Status: RUO
Workshop: III 518
Other Names: Leu-1, Ly-1, T1, Tp67
Isotype: Mouse IgG1, κ
Barcode Sequence: CATTAACGGGATGCC